Title: GPI-anchored small leucine-rich proteoglycan gene NYX
Abstract: A mammalian gene (NYX) which encodes a GPI-anchored small leucine-rich proteoglycan, nyctalopin, together with compositions and methods involving NYX and nyctalopin or homologous molecules. Mutations in NYX may cause complete X-linked congenital stationary night blindness in humans.
Patent Number: 6,875,585 Issued on 04/05/2005 to Bech-Hansen
| Inventors:
|
Bech-Hansen; N. Torben (526 - 37 Street N.W., Calgary AB, CA T2N 3B8)
|
| Appl. No.:
|
853753 |
| Filed:
|
May 14, 2001 |
Foreign Application Priority Data
| Current U.S. Class: |
435/69.1; 435/320.1; 536/23.1; 536/23.5; 530/350 |
| Intern'l Class: |
C12P 021//06; C12N 015//00; C07H 021//02; C07H 021//04; C07K 001//00 |
| Field of Search: |
435/69.1,320.1
536/23.1,23.5
530/350
|
References Cited [Referenced By]
Other References
Yan et al., 2000, Science, 290, pp. 523-527.*
Introduction to proteins and protein engineering, 1986, Elsevier, p. 41.*
Loss of Function Mutations in a Calcium-Channel.alpha..sub.1 subunit gene
in Xp11.23 cause incomplete X-linked congenital stationary Night
blindness--Paper by Bach-Hansen, et al. Jul., 1996.
Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause
X-linked incomplete cogenital stationary night blindness--Paper by
Bech-Hansen et al. Nov., 2000.
Evidence for Genetic Heterogeneity in X-linked Cogenital Stationary Night
Blindness--Paper by Bech-Hansen, et al.--published Apr. 7, 1998.
Leucine-Rich Repeat Glycoproteins of the Extracellular Matrix--Paper by
Hocking, et al. accepted Jan. 29, 1998.
|
Primary Examiner: Ulm; John
Assistant Examiner: Chernyshev; Olga N.
Attorney, Agent or Firm: Bennett Jones LLP
Claims
What is claimed is:
1. An isolated or recombinant DNA molecule encoding the amino acid sequence
of SEQ ID NO: 2.
2. The DNA molecule of claim 1 comprising a nucleotide sequence
corresponding to SEQ ID NO: 1.
3. An isolated or recombinant polynucleotide comprising a nucleotide
sequence corresponding to SEQ ID NO: 1.
4. The polynucleotide of claim 3 wherein said polynucleotide is selected
from the group comprising:
(a) RNA;
(b) cDNA; and
(c) genomic DNA.
5. An expression vector comprising one of the DNAS or polynucleotides of
claims 1, 2, 3 or 4.
6. A cultured cell comprising the expression vector of claim 5.
Description
FIELD OF THE INVENTION
The present invention is related to a gene encoding a novel small
leucine-rich proteoglycan gene. In particular, this invention relates to a
mammalian gene herein referred to as NYX, encoding a proteoglycan referred
to as nyctalopin, wherein mutations of NYX may cause complete X-linked
congenital stationary night blindness.
BACKGROUND
During mammalian retinal development a complex sequence of molecular events
leads to the precise laminations and interconnections of the mature
retina. In normal mature human retinas, rod and cone photoreceptors start
the processing of vision, which proceeds through bipolar and ganglion cell
retinal pathways to the brain [1]. Hereditary disease can perturb these
retinal pathways and cause either progressive degeneration or more
stationary visual deficits [2]. Congenital stationary night blindness
(CSNB) is a group of retinopathies that fall into the latter category of a
selective retinal pathway disturbance that manifest at birth. CSNB has
been recognized clinically for more than 100 years; genetic subtypes have
been defined; and different sites of disease action have been postulated
[3-5].
Patients with X-linked CSNB phenotypically exhibit normal fundi, but
generally have reduced visual acuity, impaired night vision and, in
addition, may exhibit myopia (or occasionally hyperopia), and nystagmus.
Based on electroretinographic findings, patients with X-linked CSNB can
have one of two forms of X-linked CSNB--complete or incomplete [4,6]. This
clinical heterogeneity correlates with underlying genetic heterogeneity in
which complete X-linked CSNB segregates with the CSNB1 locus in Xp11.4,
and incomplete X-linked CSNB segregates with the CSNB2 locus in Xp11.23
[6,7]. Patients with incomplete X-linked CSNB who show both impaired rod
and cone function were recently shown to have mutations in a voltage-gated
L-type calcium channel .alpha.-.sub.1F -subunit gene, CACNA1F [8,9]. The
electroretinographic findings in patients with complete X-linked CSNB
indicates a specific defect in the ON pathway of the retina, namely the
retinal circuitry which transmits the visual signal from the majority if
not all of the rod photoreceptor cells and a subset of the cone
photoreceptors. This signal is mediated via the rod and cone on-bipolar
retinal neurons.
The biochemical defects underlying complete X-linked CSNB is unknown but
may be revealed by identifying the gene, CSNB1, involved in this disorder.
The CSNB1 locus was reported to be on the proximal portion of the human X
chromosome, between DXS556 and DXS8083, as described previously [6].
The identification of the gene which is causative of complete X-linked CSNB
may allow for development of diagnostic tests for this disorder and risk
assessment in members of affected families. As well, identification of the
gene that is causative of complete X-linked CSNB will provide information
as to the basic defect in this retinal condition, which could lead to
effective methods for treatment or cure of the disorder. In as much as the
identification of the gene for complete X-linked CSNB and its encoded
protein will provide understanding of the general mechanism of
neurotransmission and the development of neuronal circuitry [1], this
discovery may have implications for understanding the formation of neural
circuits in general.
Leucine-rich repeat glycoproteins form part of the extracellular matrix
(ECM) of mammalian cells [10]. The major components of the ECM are
collagens, proteoglycans, glycosaminoglycans, fibronectin and, to a lesser
extent, glycoproteins. These components are organized into a fibrillar
meshwork, to provide mechanical strength and elasticity, and to create a
structural framework that provides a substratum for cell adhesion and
migration. The ECM plays an integral role in the pivotal processes of
development, tissue repair, and metastasis. Within the ECM, the
leucine-rich repeat glycoproteins are likely to perform more than a
structural role, and also likely to be involved in regulating cell growth,
adhesion and migration.
Many cell-surface proteins are anchored to the external surface of the
plasma membrane by covalently attached glycosyl-inositol phospholipids
("GPIs"). These anchors use a common structure as a general mechanism for
membrane attachment, irrespective of protein function, and are added
post-translationally at the time of the translocation of the protein
across the endoplasmic reticulum [11].
The N-terminus of a secreted protein usually consists of a cleavable leader
of 15-30 amino acids, which is called a signal sequence. The signal
sequence is both necessary and sufficient for transfer of any attached
polypeptide to the target membrane and is responsible for directing
ribosomes to attach to the endoplasmic reticulum as soon as the first few
N-terminal amino acids are synthesized [12].
The identification of the gene, mutations of which cause complete X-linked
CSNB, will aid in the elucidation of the role of the protein in retinal
function, and neurotransmission. Knowledge of the structure of this gene,
from both naturally occurring mutations and engineered variants of the
protein, will lead to studies of the structure-function relationships of
the protein in the cellular environment and its role in the disease
process. Further, the identification of the gene will provide a tool for
the diagnosis of complete X-linked CSNB in individuals suspected of having
this disorder.
SUMMARY OF THE INVENTION
The complete sequence of a gene on the short arm of the X-chromosome,
herein referred to as NYX, has been elucidated. NYX has homology to
members of the Small Leucine-Rich Proteoglycan (SLRP) family of genes,
which is a subfamily of the leucine-rich repeat superfamily of proteins.
Moreover, the NYX-encoded protein is GPI-anchored and is the only
leucine-rich repeat protein known to the Applicant that is GPI-anchored.
Mutational analysis of NYX in 22 families with complete X-linked CSNB has
identified 14 different mutations that are predicted to cause missense,
insertion, stop, or deletion mutations in the protein product of NYX,
herein referred to as nyctalopin. Together, these findings establish that
mutations in NYX cause complete X-linked CSNB.
The present invention provides a mammalian nucleotide sequence encoding a
novel small leucine-rich proteoglycan strongly expressed in the retina and
also in the kidney. Thus, in one aspect, this invention is an isolated,
recombinant or synthetic DNA molecule comprising a sequence of nucleotides
that encodes a mammalian GPI-anchored small leucine-rich proteoglycan
which is expressed in tissues including the kidney and the retina.
In one embodiment, the invention comprises an isolated, recombinant or
synthetic DNA molecule having a sequence of nucleotides selected from a
group comprising of sequences which encode for nyctalopin; an amino acid
sequence which is at least 50% homologous to nyctalopin; the amino acid
sequence of SEQ ID NO: 2; or an amino acid sequence which is at least 50%
homologous to SEQ ID NO: 2. In another embodiment, the invention comprises
an isolated, recombinant or synthetic DNA molecule or polynucleotide
comprising a nucleotide sequence which is: SEQ ID NO: 1; substantially
homologous to SEQ ID NO: 1; or a sequence that hybridizes under stringent
conditions to a hybridization probe having a nucleotide sequence of SEQ ID
NO: 1 or the complement of SEQ ID NO: 1. The polynucleotide may be
selected from the group comprising:
(a) RNA;
(b) cDNA;
(c) genomic DNA; and
(d) synthetic nucleic acids.
In another aspect, this invention comprises a substantially pure mammalian
GPI-anchored small leucine-rich proteoglycan, represented by the sequence
of amino acids set forth in FIG. 7 (SEQ ID NO:2); SEQ ID NO:2 having at
least one conservative amino acid substitution; or an amino acid sequence
which is at least 50% homologous to SEQ ID NO:2.
In another embodiment, the invention comprises a protein molecule that
encodes a murine GPI-anchored small leucine-rich proteoglycan, which is
the homologue of the human GPI-anchored human small leucine-rich
proteoglycan.
In another aspect, this invention comprises an isolated RNA sequence that
encodes a mammalian GPI-anchored small leucine-rich proteoglycan,
including a human or murine GPI-anchored small leucine-rich proteoglycan.
This invention also comprises an antisense RNA molecule having a sequence
that is complementary to the mRNA encoding a mammalian GPI-anchored small
leucine-rich proteoglycan, including a human or murine GPI-anchored small
leucine-rich proteoglycan.
In another aspect, this invention comprises an expression vector,
preferably a mammalian expression vector, comprising the nucleotide
sequence of a mammalian GPI-anchored small leucine-rich proteoglycan which
may be expressed in tissues including the kidney and the retina.
In another aspect, the invention comprises a method and diagnostic kit of
diagnosing complete X-linked CSNB, which method and kit includes the step
of and means for screening for alterations in the sequence of nucleotides
disclosed herein.
In another aspect, the invention may include a method of screening
molecules which affects expression or production of nyctalopin wherein
said method comprises the step of exposing primary or NYX transfected
cells to a drug candidate and determining the level of transcription or
translation of NYX gene products.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1: Phenotype of complete X-linked CSNB. FIG. 1A: The electroretinogram
of a patient compared with an age-matched normal. FIG. 1B: Rod and L/M
cone sensitivities measured on a 12 degree grid across the visual field of
a patient. FIG. 1C: Spectral sensitivity measurements, dark-adapted, in a
representative normal subject (open squares) and the patient (filled
triangles).
FIG. 2: Genetic characterization and physical map of the minimal region for
the CSNB1 locus. (a) Families with X-linked complete CSNB were analyzed
with genetic markers from the Xp11 region to define the boundaries of the
chromosomal position of the CSNB1 locus. The chromosomal region from seven
males that were analysed is indicated by the seven vertical lines. The
thin black vertical line on the right indicates the minimal genetic region
established for the CSNB1 gene.
"FIG. 3A: Physical map of the CSNB1 minimal region indicating the location
of overlapping BACs and PACs (short lines) and the chromosomal position of
several genes in this region, including NYX The lower horizontal line
demonstrates the genomic organization of NYX, showing that it is comprised
of three exons, with a translation start site in the second exon, a stop
codon in the third exon and a polyadenylation sequence in the 3'
untranslated region. FIG. 3B: The amino acid sequence (SEQ ID NO.: 2) of
nyctalopin shows homology with members of the SLRP family of proteins. The
protein has 11 leucine-rich repeat motifs with a 24 amino acid consensus
for small leucine-rich proteoglycans with cysteine clusters flanking the
repeat core of the protein. The conserved amino acids are shown in bold.
FIG. 3C: Dendogram showing the predicted relationship among members of
SLRP. Chondroadherin (CHAD) and nyctalopin appear to represent a fourth
class (IV) with SLRP.
FIG. 4: cDNA expression profile of NYX in various human tissues. FIG. 4A:
Upper panel shows a 755 bp fragment of the NYX mRNA in retina and kidney
tissue samples. Lower panel shows the 281 bp fragment of EST JRL4A1 which
serves as a positive control. FIG. 4B: Using a NYX-antisense
digoxigenin-labelled riboprobe (NYX-AS) for in situ hybridization in human
retinal sections showing the expression of NYX in the inner segment (IS)
of photoreceptors, in the outer- and inner-nuclear layers (ONL, INL), and
in the ganglion cell layer (GCL). FIG. 4C: No significant staining was
observed using a NYX-sense probe. FIG. 4D: Rhodopsin-antisense probe
(RHO-AS) labelled rod photoreceptors in the IS and ONL.
FIG. 5A: Identification of a putative nonsense mutation in families 610 and
620 in exon 3 (at nucleotide 1049) caused by a G to A transition, which
changes a Trp to a stop codon. Segregation analysis of this mutation was
performed by restriction endonuclease digestion. Affected individuals show
the loss of a FokI restriction site, female carriers have fragments
indicating both the presence and absence of this restriction site, and
unaffected males show only the FokI site. FIG. 5B: Identification of a
24-bp deletion observed in seven (six shown) different families. This
mutation results in the loss of eight amino acids beginning at codon 29.
The segregation of the 24-bp deletion was performed by PCR amplification
of genomic DNA and the products were subjected to agarose gel
electrophoresis. The presence of the smaller PCR fragment representing the
deletion was observed in affected males and carrier females. FIG. 5C:
Identification of an insertion mutation of 21 nt between nucleotides 444
and 445 in patient 650-1, which results in the addition of seven amino
acids to the protein. FIG. 5D: Identification of a missense mutation in
patient P520-IV-27 caused by a T to A transversion at nucleotide 638,
which changes a Leu codon to a Gln codon.
FIG. 6: Summary of the 14 mutations of NYX detected in 22 families with
complete X-linked CSNB. Mutation refers to the position of the nucleotide
changes, including insertions, deletions and changes. `Codon change` shows
the codons which have been changed by the mutations in NYX.
FIG. 7: Nucleotide sequence of human NYX (SEQ ID NO:1) with the amino acid
sequence of nyctalopin in single letter code underneath (SEQ ID NO:2).
DETAILED DESCRIPTION OF THE INVENTION
The details of the preferred embodiments of the present invention are set
forth in the accompanying drawings and description below. Based on the
details of the invention described herein, numerous additional innovations
and changes will become obvious to one skilled in the art.
Unless otherwise indicated, all terms used herein have the same meaning as
is commonly understood by one skilled in the art of the present invention.
Practitioners are particularly directed to Current Protocols in Molecular
Biology (Ausubel) or Maniatis et al., Cold Spring Harbor, N.Y., Cold
Spring Harbor Laboratory (1990), for terms of the art.
The term "carrier" refers to a female who is heterozygous for a single
recessive gene and does not have the phenotype associated with complete
X-linked CSNB. The terms "isolated" or "substantially pure" nucleic acid
or polynucleotide (e.g., an RNA, DNA or a mixed polymer) is one that is
substantially separated from other cellular components that naturally
accompany a native human sequence or protein, e.g., ribosomes,
polymerases, many other human genome sequences and proteins. The term
embraces a nucleic acid sequence that has been removed from its naturally
occurring environment, and includes recombinant or cloned DNA isolates and
chemically synthesized analogs or analogs that are biologically
synthesized by heterologous systems.
The term "encode" refers to the following: DNA or a polynucleotide is said
to "encode" a polypeptide if, in its native state or when manipulated by
methods well known to those skilled in the art, it can be transcribed
and/or translated to produce the mRNA for and/or the polypeptide or a
fragment thereof. The anti-sense strand is the complement of such a
nucleic acid, and the encoding sequence can be deduced therefrom.
The term "expression vector" refers to a recombinant DNA construct that
comprises, among other elements, a DNA sequence of which expression is
desired. An "expression vector" is used to introduce heterologous DNA into
cells for expression of the heterologous DNA, as either an episomal
element, or after incorporation into the cellular genome. An "expression
vector" will contain all of the elements necessary for transcription of
the DNA sequence functionally linked to the DNA sequence, including but
not limited to a transcription initiation element, a transcription
termination element, and elements that modulate expression of the DNA
sequence, such as promoters or enhancers. These elements may be native to
the DNA sequence of which expression is desired. An expression vector may
contain elements that will regulate translation, if translation of the
resultant RNA transcript into a protein product is desired.
The term "heterologous" refers to DNA or RNA that does not occur, in
nature, as part of the genome in which it is present, which is found in a
location or locations in the genome that differ from that in which it
occurs in nature, or which is present in the genome as a result of human
manipulation of the genome. It is DNA or RNA that is not endogenous to the
cell in which it is found, or that is endogenous to the cell but which has
been manipulated in vitro, and has been artificially introduced into the
cell. Heterologous DNA or RNA need not be incorporated into the host cell
genome, but may be maintained episomally.
The term "nyctalopin" refers to the protein encoded by NYX, and includes
variants thereof which occur in nature or which can be generated
experimentally. Such variants include proteins that have conservative
amino acid substitutions, or those which have alterations in amino acid
sequence that affect protein function. Included within the definition are,
for example, polypeptides containing one or more analogs of an amino acid
(including, for example, unnatural amino acids, etc.), polypeptides with
substituted linkages as well as other modifications known in the art, both
naturally and non-naturally occurring. Ordinarily, such polypeptides will
be at least about 50% homologous to the native nyctalopin sequence,
preferably in excess of about 90%, and more preferably at least about 95%
homologous. Also included are proteins encoded by DNA which hybridize
under high or low stringency conditions, to nyctalopin-encoding nucleic
acids and closely related polypeptides or proteins retrieved by antisera
to nyctalopin.
The terms "substantial homology" or "substantial identity", when referring
to polypeptides, indicate that the polypeptide or protein in question
exhibits at least about 30% identity with an entire naturally-occurring
protein or a portion thereof, usually at least about 70% identity, and
preferably at least about 95% identity. Homology, for polypeptides, is
typically measured using sequence analysis software. See, e.g., the
Sequence Analysis Software Package of the Genetics Computer Group,
University of Wisconsin Biotechnology Center, 910 University Avenue,
Madison, Wis. 53705. Protein analysis software matches similar sequences
using measure of homology assigned to various substitutions, deletions and
other modifications. Conservative substitutions typically include
substitutions within the following groups: glycine, alanine; valine,
isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine;
serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
The terms "isolated", "substantially pure", "purified", "purified and
isolated" and "substantially homogeneous" are used interchangeably to
describe a protein or polypeptide that has been separated from components
that accompany it in its natural state. A monomeric protein is
substantially pure when at least about 60 to 75% of a sample exhibits a
single polypeptide sequence. A substantially pure protein will typically
comprise about 60 to 90% W/W of a protein sample, more usually about 95%,
and preferably will be over 99% pure. Protein purity or homogeneity may be
indicated by a number of means well known in the art, such as
polyacrylamide gel electrophoresis of a protein sample, followed by
visualizing a single polypeptide band upon staining the gel with a stain
well known in the art. For certain purposes, higher resolution may be
provided by using HPLC or other means well known in the art for
purification.
The term "NYX" refers to the gene that encodes for nyctalopin, and includes
untranslated regions and regulatory and promoter sequences which influence
the expression of the gene and the translation of the transcript. In the
appropriate context, NYX may refer to the cDNA product of this gene or
other polynucleotides. These nucleic acids comprise a sequence which is
either derived from, or substantially similar to a natural
nyctalopin-encoding gene or one having substantial homology with a natural
nyctalopin-encoding gene or a portion thereof.
The term "substantial homology or similarity" when referring to a nucleic
acid or fragment thereof indicates that when optimally aligned (with
appropriate nucleotide insertions or deletions) with the other nucleic
acid (or its complementary strand), there is nucleotide sequence identity
in at least about 60% of the nucleotide bases, usually at least about 70%,
more usually at least about 80%, preferably at least about 90%, and more
preferably at least about 95-98% of the nucleotide bases.
Alternatively, substantial homology or similarity exists when a nucleic
acid or fragment thereof hybridizes to another nucleic acid (or a
complementary strand thereof) under selective hybridization conditions, to
a strand, or to its complement. Selectivity of hybridization exists when
hybridization which is substantially more selective than total lack of
specificity occurs. Typically, selective hybridization will occur when
there is at least about 55% homology over a stretch of at least about 14
nucleotides, preferably at least about 65%, more preferably at least about
75%, and most preferably at least about 90%. The length of homology
comparison, as described, may be over longer stretches, and in certain
embodiments will often be over a stretch of at least about nine
nucleotides, usually at least about 20 nucleotides, more usually at least
about 24 nucleotides, typically at least about 28 nucleotides, more
typically at least about 32 nucleotides, and preferably at least about 36
or more nucleotides.
Nucleic acid hybridization will be affected by such conditions as salt
concentration, temperature, or organic solvents, in addition to the base
composition, length of the complementary strands, and the number of
nucleotide base mismatches between the hybridizing nucleic acids, as will
be readily appreciated by those skilled in the art. Stringent temperature
conditions will generally include temperatures in excess of 30.degree. C.,
typically in excess of 37.degree. C., and preferably in excess of
45.degree. C. Stringent salt conditions will ordinarily be less than 1000
mM, typically less than 500 mM, and preferably less than 200 mM. However,
the combination of parameters is much more important than the measure of
any single parameter. See, e.g., Wetmur and Davidson, 1968. Probe
sequences may also hybridize specifically to duplex DNA under certain
conditions to form triplex or other higher order DNA complexes. The
preparation of such probes and suitable hybridization conditions are well
known in the art. Generally, the terms "high stringency" or "conditions of
high stringency" generally means washing at low salt concentration, less
than about 0.2 and preferably about 0.1 SSPE, and at high temperature,
more than about 60.degree. C. and preferably about 65.degree. C. It will
be understood that an equivalent stringency may be achieved by using
alternative buffers, salts and temperatures.
The polynucleotide compositions of this invention include RNA, cDNA,
genomic DNA, synthetic forms, and mixed polymers, both sense and antisense
strands, and may be chemically or biochemically modified or may contain
non-natural or derivatized nucleotide bases, as will be readily
appreciated by those skilled in the art. Such modifications include, for
example, labels, methylation, substitution of one or more of the naturally
occurring nucleotides with an analog, internucleotide modifications such
as uncharged linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoramidates, carbamates, etc.), charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g.,
polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators,
alkylators, and modified linkages (e.g., alpha anomeric nucleic acids,
etc.) Also included are synthetic molecules that mimic polynucleotides in
their ability to bind to a designated sequence via hydrogen bonding and
other chemical interactions. Such molecules are known in the art and
include, for example, those in which peptide linkages substitute for
phosphate linkages in the backbone of the molecule.
The term "precursor" refers to a protein with the amino acid sequence
corresponding to the sequence of the full length MRNA which, upon
translation, results in a protein which may be further processed to form
the mature nyctalopin.
The term "antibodies" refers to polyclonal and/or monoclonal antibodies and
fragments thereof, and immunologic binding equivalents thereof, which are
capable of specifically binding to the nyctalopin and fragments thereof or
to polynucleotide sequences from the NYX locus or a portion thereof. The
term "antibodies" is used both to refer to a homogeneous molecular entity,
or a mixture such as a serum product made up of a plurality of different
molecular entities. Polypeptides may be prepared synthetically in a
peptide synthesizer or as fusion proteins as described above and coupled
to a carrier molecule (e.g., keyhole limpet hemocyanin) and injected over
several months into rabbits, mice, goats, etc. Sera is tested for
immunoreactivity to nyctalopin or fragment. Monoclonal antibodies may be
made by injecting mice with the protein polypeptides, fusion proteins or
fragments thereof. Monoclonal antibodies are screened by ELISA and tested
for specific immunoreactivity with nyctalopin or fragments thereof. These
antibodies will be useful in assays and as pharmaceuticals.
Once a sufficient quantity of desired polypeptide has been obtained, it may
be used for various purposes. A typical use is the production of
antibodies specific for binding. These antibodies may be either polyclonal
or monoclonal, and may be produced by in vitro or in vivo techniques well
known in the art. For production of polyclonal antibodies, an appropriate
target immune system, typically mouse or rabbit, is selected.
Substantially purified antigen is presented to the immune system in a
fashion determined by methods appropriate for the animal and by other
parameters well known to immunologists. Typically the injections are
performed in footpads, intramuscularly, intraperitoneally, or
intradermnally. Of course, other species may be substituted for mouse or
rabbit. Polyclonal antibodies are then purified using techniques known in
the art, adjusted for the desired specificity.
An immunological response is usually assayed with an immunoassay. Normally,
such immunoassays involve some purification of a source of antigen, for
example, that produced by the same cells and in the same fashion as the
antigen. A variety of immunoassay methods are well known in the art. See,
e.g., Harlow and Lane, 1988, or Goding, 1986.
Monoclonal antibodies with affinities of 10.sup.-8 M.sup.-1 or preferably
10.sup.-9 to 10.sup.-10 M.sup.-1 or stronger are typically made by
standard procedures as described, e.g., in Harlow and Lane, 1988 or
Goding, 1986. Briefly, appropriate animals are selected and the desired
immunization protocol followed. After the appropriate period of time, the
spleens of such animals are excised and individual spleen cells fused,
typically, to immortalized myeloma cells under appropriate selection
conditions. Thereafter, the cells are clonally separated and the
supernatants of each clone tested for their production of an appropriate
antibody specific for the desired region of the antigen.
Other suitable techniques involve in vitro exposure of lymphocytes to the
antigenic polypeptides, or alternatively, to selection of libraries of
antibodies in phage or similar vectors. See Huse et al., 1989. The
polypeptides and antibodies of the present invention may be used with or
without modification. Frequently, polypeptides and antibodies will be
labeled by joining, either covalently or non-covalently, a substance which
provides for a detectable signal. A wide variety of labels and conjugation
techniques are known and are reported extensively in both the scientific
and patent literature. Suitable labels include radionuclides, enzymes,
substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent
agents, magnetic particles and the like. Patents teaching the use of such
labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149 and 4,366,241. Also, recombinant immunoglobulins may
be produced (see U.S. Pat. No. 4,816,567).
The term "epitope" refers to a region of a polypeptide that provokes a
response by an antibody. This region needs not comprise consecutive amino
acids. The term epitope is also known in the art as "antigenic
determinant".
Mapping the Location of the Gene for Complete X-linked CSNB
The CSNB1 locus was previously reported to be located on the proximal
portion of the human X chromosome, between DXS556 and DXS8083 [6]. By
analyzing additional families with complete X-linked CSNB, and by using
new polymorphic markers developed on the basis of dinucleotide repeats
within this minimal region, the minimal region can be further refined.
Analysis of selected recombinant X chromosomes in the set of families with
complete X-linked CSNB moves the distal boundary of the CSNB1 minimal
region from DXS556 to the interval between 200L4CA1 and DXS8012 (FIG. 2
and FIG. 3(a)). From further analysis, the proximal crossover previously
observed in patient V:1 in family P23 [19] limits the proximal boundary to
between DXS1207 and DXS228 (FIG. 2 and FIG. 3(a)). Therefore, the minimal
region for the CSNB1 locus is limited to the interval between 200L4CA1 and
DXS228 in Xp11.4. The methods used for localizing genes on human
chromosomes using these and other techniques are known to those skilled in
the art.
Identification of a Candidate Gene for CSNB1
To position genetic markers accurately across the CSNB1 minimal region and
identify candidate genes for the CSNB1 locus, a robust physical map of the
CSNB1 minimal region in Xp11.4 may be developed. A subset of BAC and PAC
clones from the minimal tiling path of the estimated 1.2 Mb CSNB1 minimal
region is sequenced to between 1-2.7-fold redundancy. A sub-library is
constructed [20] for each of the BAG clones and random clones from each
sub-library are sequenced with the aid of ABI 373 or ABI 377 sequencing
machines and fluorescently labeled primers (ABI, Amersham). DNAStar.TM.
software is used for gel trace analysis and contig assembly as well as DNA
and protein alignments. DNA and protein sequences are then examined
against available public databases using the various Blast.TM. programs
available through the network server at the National Center for
Biotechnology Information. A novel open reading frame is present in this
region, which the Applicant has designated to be the NYX gene.
Candidates for the CSNB1 gene are expected to be expressed in the retina
and located in the CSNB1 minimal region. Expression of NYX is assessed by
PCR amplification of a QUICK-Screen.TM. Human cDNA Library Panel
(Clontech), using primers which span exons 1 to 3. PCR products are
electrophoresed through a 1% agarose gel and visualized by ethidium
bromide staining. The 755-bp PCR product is detected robustly in the
retinal and kidney cDNA library (FIG. 3). RNA in situ hybridization is
performed as described [21-23], using a 668-bp antisense probe (from
nt1557-2224 of the cDNA). These studies reveal that retinal expression of
NYX occurs predominantly in the inner- and outer-nuclear layers of the
human retina but is also seen in some cells of the ganglion cell layer
(FIG. 4).
The extended NYX cDNA sequence is established by sequencing of PCR and RACE
products using first-strand cDNA from total human retinal RNA as the
template for PCR. Touchdown PCR using the Failsafe.TM. PCR Premix
Selection Kit is carried out according to the manufacturer's protocol
(Epicentre Technologies). RACE is carried out using Human Retina cDNA
Marathon-Ready.TM. cDNA (Clontech). A secondary amplification using a
nested NYX primer is performed. RACE and PCR products are gel purified
using the Concert.TM. Gel Extraction kit (Life Technologies) and sequenced
using the ThermoSequenase.TM. P-radiolabelled terminator cycle sequencing
kit (Amersham Life Science). To establish the genomic organization of the
NIX gene, the full-length cDNA sequence of NYX is compared to the genomic
sequence derived from our analysis of BAC clone 378P5 and that produced by
the Sanger Centre for BAC clone 16915.
The cDNA sequence of NYX consists of a 1443 bp open reading frame that
codes for a protein of 481 amino acids (FIG. 7). The 5'-untranslated
region is 98 bp long, and the translation initiation site lies in exon 2.
A polyadenylation site lies 688 nt downstream from the stop codon of the
open reading frame, and the 3'-untranslated region is at least 753 bp
long. On the X chromosome, NYX is organized in three exons, spanning 28 kb
of genomic sequence. The 3'-end lies 26 kb distal to the proximal end of
PAC clone 16915 (FIG. 3). The open reading frame of NYX is contained in
exons 2 and 3. Intron 2 spans 25.5 kb and encompasses the marker DXS8012.
Characteristics of Nyctalopin
NYX encodes a 481 ammo acid protein, herein called nyctalopin, which has
sequence similarity with members of the superfamily of proteins containing
tandem arrays of the leucine-rich repeat (LRR) motif [10,13]. Such
proteins are known to function in protein--protein interactions,
especially in matrix assembly, and therefore nytalopin_may possibly be
mediating specific neural connections between cells in the retina.
Moreover, the presence of the 24 amino acid consensus:
x-x-I/V/L-x-x-x-x-F/P/L-x-x-L/P-x-x-L-x-x-L/I-x-L-x-x-N-x-I/L (where
I,V,L,F,P and N are single letter amino acid codes and "x" represents any
amino acid) in the core protein with cysteine clusters flanking the LRR
domain (see FIG. 3B) [SEQ ID NO: 2], qualifies nyctalopin as a new member
of the subfamily of small leucine-rich proteoglycans (SLRPs) [10]. From a
homology comparison of nyctalopin with other SLRP proteins, it is evident
that nyctalopin is a unique member of this subfamily and the LRR
superfamily in general. Nyctalopin has five putative consensus sequences
(N-X-(S/T)) necessary for substitution by N-linked oligosaccharides or
keratan sulfate [14], three of these sequences lie within the LRR region.
The NH.sub.2 -terminal end of nyctalopin is predicted [15] to contain a
membrane signal peptide with a putative cleavage site between amino acid
23 and 24. AWA-VG (FIG. 3). In addition, the carboxyl-terminal region of
nyctalopin contains a GPI-anchor signal sequence, including the requisite
GPI N-terminal signal sequence (amino acids 339 to 379), the C-terminal
hydrophobic region (last 22 amino acids) and a potential cleavage site at
amino acids 445-447 [16] (FIG. 3B) [SEQ ID NO: 2. The identification of
these sites was accomplished at the website www.expasy.expasy.ch/tools and
is well known to those skilled in the art. Thus, NYX codes for a
GPI-anchored proteoglycan with a putative membrane signal peptide. Without
being limited to a theory, these results suggest that the clinical
features of complete X-linked CSNB can be explained by the presence of a
mutant nyctalopin (or entire absence of nyctalopin) causing the disruption
of selected connections or interactions between retinal neurons, including
those of the retinal ON-bipolar pathway, possibly during early stages of
embryonic development.
It is understood that, because of genetic redundancy, the nucleotide
sequence of NYX disclosed herein may be modified by making variations in
sequence that do not alter the amino acid sequence of the resultant
protein. The nucleotide sequence may also be modified to make conservative
amino acid substitutions to the resultant protein, which do not alter, or
do not significantly alter, the biological activity of the resulting
molecule. The resulting modified nucleotide sequences are contemplated
herein.
It is understood that the amino acid sequence of nyctalopin disclosed
herein may be modified by making minor variations in sequence, such as
conservative amino acid substitutions or minor deletions or insertions
that do not alter the activity of the protein, and the resulting modified
proteins are contemplated herein. Suitable conservative substitutions of
amino acids are known to those of skill in this art, and may be made
generally without altering, or significantly altering, the biological
activity of the resulting molecule. Such substitutions may also be made
empirically.
Expression Systems
For expression of NYX or nyctalopin, eukaryotic or prokaryotic expression
systems may be designated in which the NYX sequence is introduced into a
plasmid or other vector which is then introduced into living cells.
Expression vectors may contain the entire open reading frame of NYX or
alternatively, only portions of the normal, polymorphic or mutant NYX
sequences.
Typical expression vectors contain promoters that direct the synthesis of
large amounts of mRNA corresponding to the sequence to be expressed. They
may also contain, among other things, sequences that allow for autonomous
replication within the host organism, sequences that encode positive or
negative selectable markers, and sequences that increase the efficiency of
mRNA translation. Expression vectors may be maintained in a cell as freely
replicating entities by using regulatory elements of viruses, or
alternatively cell lines may be produced which have integrated the
expression vector or a part thereof into the genomic DNA.
Expression of foreign sequences in bacteria such as E. coli requires the
insertion of the sequence into a vector, usually a plasmid, which contains
several elements such as sequences encoding a selectable marker genes, a
controllable transcription promoter, translation control sequences and a
polylinker. A relatively simple vector that can be used in E. coli is
pBluescript.TM. which utilizes the lacZ promoter and a neighbouring lacZ
gene whose function is disrupted when the foreign gene sequence is
inserted into the vector.
In vitro expression of vectors which use the T7 late-promoter expression
system or plasmid vectors containing late promoters and the corresponding
RNA polymerases from related bacteriophages such as T3, T5 and SP6 may be
used for in vitro production of proteins from cloned DNA. E. coli can also
be used for expression by infection with M13 Phage mGPI-2.
Eukaryotic expression systems can be used if appropriate post-translational
modification of expressed proteins is desired. This allows for studies of
the NYX gene and gene product including, for example, determination of the
post-translational modifications required for biological activity or
identifying regulatory elements in the 5' region of the gene and their
role in tissue regulation of protein expression. Expression in eukaryotic
systems will permit the production of large amounts of normal functional
protein and mutant protein for isolation and purification, and provides
cells which express NYX and can be used as a functional assay system, such
as for testing of the effectiveness of pharmacological agents or studying
the function of the normal protein, naturally occurring polymorphisms,
artificially produced mutated proteins, or specific portions thereof.
In order to produce mutated or polymorphic proteins, the NYX sequence can
be altered using procedures such as DNA polymerase fill-in, exonuclease
deletion, terminal deoxynucleotide transferase extension, ligation of
synthetic DNA sequences and site-directed sequence alteration using
specific oligonucleotides generated by PCR.
Once an expression vector containing NYX or a portion thereof is
constructed, it is introduced into an appropriate E. coli strain by
transformation techniques including calcium phosphate transfection,
DEAE-dextran transfection, electroporation, microinjection, protoplast
fusion and liposome-mediated transfection. The host to be transfected with
the expression vector of this invention may be selected from the group
consisting of E.coli, Pseudomonas, Bacillus subtilis, or other bacilli or
bacteria, yeast, fungi, insect (using baculoviral vectors for expression),
mouse or other animal or human tissue cells. Mammalian cells can also be
used to express the nyctalopin using a vaccinia virus expression system.
Prokaryotic and eukaryotic expression systems allow various important
functional domains of the protein to be recovered as fusion proteins and
used for binding, structural and functional studies and also for the
generation of appropriate antibodies.
Fusion proteins are particularly advantageous because they provide a system
for ensuring high levels of expression of the protein of interest and
relatively simple purification thereof. In order to make a nyctalopin
fusion protein, the NYX sequence is inserted into a vector which contains
a nucleotide sequence encoding the amino terminus of a protein that is
abundantly expressed (eg. GST--glutathionine succinyl transferase). The
NYX sequence is inserted 3' and in frame to this nucleotide sequence, is
expressed and recovered from the prokaryotic (eg. bacterial or
baculovirus) or eukaryotic cells. The fusion protein can then be purified
by affinity chromatography and, if desired, the nyctalopin obtained by
enzymatic cleavage of the fusion protein.
The preparation of substantially purified nyctalopin or fragments thereof
allows the determination of the protein tertiary structure by x-ray
crystallography or by NMR. Determination of structure may aid in the
design of pharmaceuticals to interact with the protein, alter protein
charge configuration or charge interaction with other proteins, or to
alter its function in the cell.
Mutation and Segregation Analysis of NYX
To identify which mutations in NYX cause complete X-linked CSNB, primers
flanking and internal to each exon are used for direct DNA sequence
analysis of the entire NYX gene in affected individuals from families with
complete X-linked CSNB. Primers are designed, genomic DNA is amplified and
PCR products are purified and sequenced using methods known to those
skilled in the art.
Once a DNA sequence change is identified by the mutation analysis, aside
from DNA sequencing, segregation analysis may be accomplished by a number
of techniques. Allele sizing, as described in [18] can be used to follow
as little as a single base-pair insertion or deletion in a gene.
Alternatively, the segregation of a larger insertion or deletion, such as
the 24 bp deletion mutation found in one patient with complete X-linked
CSNB, can be followed by PCR analysis and gel electrophoresis. Primers are
used to amplify by PCR, in affected, non-affected and carrier individuals,
the region that encompasses the deletion (or insertion) of the nucleotide
sequence. After electrophoresis of the amplified products on an agarose
gel (or a polyacrylamide gel), the deletion (or insertion) is detected by
the presence of a PCR fragment which is smaller (or larger) than the PCR
fragment from a normal gene.
Alternatively, segregation analysis may be accomplished by following the
loss or gain of restriction endonuclease recognition sites (restriction
sites). Mutated and wild-type sequences are analyzed by a DNA analysis
program, for example DNA Strider1.2.TM., looking for changes in DNA
sequence that would result in a loss or gain of a restriction site. Once
found, these changes can be used to track the mutation in families of
affected individuals. Firstly, PCR is used to amplify the region of
interest from the genomic DNA of affected, non-affected and carrier
individuals. The PCR products are digested with the enzyme that will
detect the mutation (in either a positive or negative sense). The digested
products are electrophoresed through agarose and visualized to determine
whether the restriction enzyme site is present or not, whichever the case
may be, in the individual analysed.
Numerous additional methods for identifying mutations of NYX in
individuals, or tracing mutations of NYX through families are obvious to
one skilled in the art. Other useful diagnostic techniques include, but
are not limited to:
(a) direct DNA sequencing;
(b) analysis of restriction length polymorphism;
(c) single-stranded conformation analysis or heteroduplex analysis;
(d) RNAse protection;
(e) the use of proteins that recognize nucleotide mismatches, such as the
E. coli mutS protein;
(f) single nucleotide extension assays;
(g) microchip technology analysis;
(h) Northern blot analysis;
(i) Southern blot analysis;
(j) dot blot analysis;
(k) PCR analysis;
(l) fluorescent in situ hybridization analysis; and
(m) two-step label amplification analysis;
(n) PFGE analysis; and
(o) allele-specific oligonucleotide (ASO) analysis.
The newly developed technique of nucleic acid analysis via microchip
technology is also applicable to the present invention. In this technique,
thousands of distinct oligonucleotide probes are embedded in an array on a
silicon or glass chip. Nucleic acid to be analyzed is fluorescently
labeled and hybridized to the probes on the chip. Using this technique one
can determine the presence of mutations or even sequence the nucleic acid
being analyzed, or one can measure expression levels of a gene of
interest. A major advantage of this method is that parallel processing of
many, even thousands, of probes at once can be accomplished and thereby
increase the rate of analysis tremendously.
Alteration of NYX MRNA expression can be detected by any techniques known
in the art. These include Northern blot analysis, PCR amplification and
RNase protection. Diminished mRNA expression indicates an alteration of
the wild-type NYX gene. Alteration of wild-type NYX genes can also be
detected by screening for alteration of wild-type NYX protein. For
example, monoclonal antibodies immunoreactive with NYX can be used to
screen a tissue. Lack of cognate antigen would indicate a NYX mutation.
Antibodies specific for products of mutant alleles could also be used to
detect mutant NYX gene product. Such immunological assays can be done in
any convenient formats known in the art. These include Western blots,
immunohistochemical assays and ELISA assays. Any means for detecting an
altered NYX protein can be used to detect alteration of wild-type NYX
genes. Functional assays, such as protein binding determinations, can be
used. In addition, assays can be used that detect NYX biochemical
function, for instance, DNA binding. Finding a mutant NYX gene product
indicates presence of a mutant NYX allele.
Possible consequences of NYX mutations
Fourteen different mutations have been identified in NYX, none of which are
observed in chromosomes from normal individuals. In nyctalopin, there are
11 leucine-rich repeats, which are all highly conserved with respect to
the consensus sequence in SLRPs, and these are flanked by cysteine
clusters (see FIG. 3B) [SEQ ID NO: 2] [10]. The deletion of a portion of
the oysteine cluster in the amino-terminal portion of nyctalopin appears
to be responsible for complete X-linked CSNB in six families, which
highlights the importance of this conserved region. The mutation that
causes a stop codon on the carboxyl-terminal side of the leucine-rich
repeats and another cysteine cluster, likely affects the ability of the
protein to anchor in the membrane, as the protein portion on the
carboxyl-terminal side of this mutation is presumed to be important for
GPI anchoring nyctalopin in the cellular membrane. Mutations that replace
a consensus amino acid with another amino acid axe presumed to disrupt an
essential amino acid function. Mutations that result in the insertion (or
deletion) of amino acids in the protein are presumed to alter the folding
of the protein
Missense mutations, and additions or deletions of amino acids are predicted
to disrupt specific functions of intact nyctalopin and therefore may be
informative as to the structure-function relationship of the protein. Such
information is presumed to be useful for targeting therapy for retinal
disease, either by direct action on nyctalopin or, indirectly, on proteins
which interact with nyctalopin.
Construction of Full-Length cDNA Clones
Full length cDNA clones are constructed by a variety of methods known to
those skilled in the art. Such methods include screening a cDNA library
with a labeled DNA probe of the gene of interest, identifying overlapping
cDNA clones and ligating them together into one clone that contains the
entire coding region. One can also obtain a full length cDNA clone in one
step from a library, obviating the need to perform intermediary ligation
steps. If the 5' or 3' end only of the clone is missing, methods such as
RACE (rapid amplification of cDNA ends) are used to complete the sequence,
or if the full length sequence is known, PCR amplification and ligation of
the fragments onto the ends of the cDNA clone may be used. The cDNA
product is cloned into the vector of choice, such as a pUC.TM. vector or
pBluescript.TM..
Alternatively, PCR is used to amplify the gene from a cDNA library or a
cDNA preparation using a Taq Polymerase that is designed for long range
PCR, such as Pfu.TM. or Vent.TM. Polymerase, and the PCR fragment is
ligated into a the vector of choice. A preferred vector is PCR2.1-TOPO.TM.
(Invitrogen). The PCR primer at the 5' end (the forward primer) is
designed to contain a small ribosomal binding site. The forward primer and
the PCR primer at the 3' end (the reverse primer) also contain recognition
sites for extremely rare cutting restriction endonucleases, such as NotI,
for cloning into the vector. If the entire cDNA sequence cannot be
obtained in one step, then overlapping PCR fragments can be amplified and
ligated together into a vector using methods known to those skilled in the
art. PCR products are verified by DNA sequencing and restriction
digestion, to ensure that they are identical in sequence to the native
cDNA. After ligation into the vector, the fragments are again checked for
accuracy by restriction analysis or DNA sequencing. A person skilled in
the art may modify these methods as necessary, depending upon the
exigencies presented in each particular step of the assembly.
Identification and Characterization of Murine NYX
The knowledge of the sequence of the human NYX gene can be used to identify
and isolate the homologous gene in other mammalian species. Mouse retinal
cDNA can be amplified by PCR with the primers used to amplify the human
NYX gene or with other primers, such as degenerate primers, that are
designed by reference to the human NYX sequence. Amplified PCR fragments,
which are similar in size as the human PCR products, are sequenced and
compared to the human NYX sequence. Any fragments with substantial
homology (approximately 90%) to the human sequence are presumed to be
portions of the murine NYX gene.
To obtain the remainder of the murine NYX sequence, mouse specific primers
sets can be designed from the mouse sequence known to that point. These
primers can be used to amplify the additional regions of murine NYX.
Finally, the 5' and 3' ends of the murine cDNA sequence for NYX can be
obtained by 5' and 3' RACE, using the Marathon.TM. cDNA Amplification Kit
(Clontech). These methods are well known to those skilled in the art.
Drug Screening
The invention may be useful to screen for molecules that stimulate or
inhibit nyctalopin expression. Therefore, the present invention provides
methods of screening for molecules having effect in cultured cells, either
primary or transfected versions, by assaying for the levels of nyctalopin
production by immunoprecipitation, or Western blotting and NYX
transcription by Northern blotting, which are well known in the art.
EXAMPLES
The following examples are intended to illustrate but not limit the
invention. While they are typical of those that might be used, other
procedures known to those skilled in the art may alternatively be
utilized.
Example 1--
Identification of the Genomic Region Containing the CSNB1 Locus
Twenty-four families with complete X-linked CSNB were included in this
study. The diagnosis of complete X-linked CSNB in these families involved
electrophysiological and psychophysical testing [18], which established
the reduction or alteration of the rod pathway-- and cone pathway-mediated
function in the retina of these patients. The results of this type of
testing on normal and affected subjects is shown in FIG. 1. FIG. 1A shows
that the virtual absence of a rod response, the relative preservation of
the scotopic white-flash a-wave with a severely subnormal b-wave, and the
loss of the first two major photopic oscillatory potentials for
thephotopic single flash. FIG. 1B shows the loss of rod sensitivity across
the retina, and scattered loss of cone sensitivity. FIG. 1C the spectral
sensitivity measurements, dark adapted, in a normal subject and a patient.
The preliminary genotype analysis of our families was performed as
described [6,7]. Three new markers were developed based on dinucleotide
repeats that were identified in large-scale DNA sequence. Primers pairs
for these markers are as follows:
TABLE 1
Polymorphism Forward Primer Reverse Primer
506B13CA1 atcacagtgccctgcctaaa tcccaaagtgctgggattac
(DXS10042) (SEQ IDNO: 3) (SEQ IDNO: 4)
200L4CA1 gaacagcaaaccaaatccaaa ggcctatggtaatgcctcct
(DXS10044) (SEQ ID NO: 5) (SEQ ID NO: 6)
169I5CA2 aaacttagctgggcatgctg gctgggactacatacagcaca
(DXS10045) (SEQ ID NO: 7) (SEQ ID NO: 8)
Using these markers and other known markers, an analysis of selected
recombinant X chromosomes in the set of families with complete X-linked
CSNB enable us to moved the distal boundary of the CSNB1 minimal region
from DXS556 to the interval between 200L4CA1 and DXS8012 (FIG. 2 and FIG.
3A). From further analysis, the proximal crossover previously observed in
patient V:1 in family P23 [19] was limited to the interval between DXS
1207 and DXS228 (FIG. 2 and FIG. 3A).
Example 2--
Sequence of the full length NYX cDNA
To position genetic markers accurately across the CSNB1 minimal region and
identify candidate genes for the CSNB1 locus, a robust physical map of the
CSNB1 minimal region in Xp11.4 was developed. A subset of BAC and PAC
clones from the minimal tiling path of the estimated 1.2 Mb CSNB1 minimal
region is shown in FIG. 3. BAC clones 378P5, 36P21, 160H17, and 317C4,
which had not been sequenced at the Sanger Center, were sequenced to
between 1-2.7-fold redundancy to identify additional candidate genes. A
sub-library was constructed [20] for each of the BAC clones. DNA from each
BAC was isolated, randomly sheared by nebulization, and fractionated by
agarose gel electrophoresis. Fragments (2-4 kb) were collected,
blunt-ended, and cloned into M13mp19 using standard techniques. Random
clones from each sub-library were sequenced with the aid of ABI 373 or ABI
377 sequencing machines and fluorescently labeled primers (ABI, Amersham).
DNAStar.TM. software was used for gel trace analysis and contig assembly
as well as DNA and protein alignments. DNA and protein sequences were
examined against available public databases using the various Blast.TM.
programs available through the network server at the National Center for
Biotechnology Information.
The extended NYX cDNA sequence was established by sequencing of PCR and
RACE products. First-strand cDNA from total human retinal RNA was used as
the template for PCR. Touchdown PCR using the Failsafe.TM. PCR Premix
Selectio
