Identification of sel-12 and uses thereof Number:6,787,641 from the United States Patent and Trademark Office (PTO) owispatent This invention provides an isolated nucleic acid molecule encoding a SEL-12. This invention further provides an isolated nucleic acid molecule which encodes a mutated SEL-12. This invention also provides an isolated nucleic acid molecule which encodes a mutated SEL-12, wherein the mutated SEL-12 contains at least one of the following: position 115 is a leucine, position 132 is an arginine, position 215 is a glutamic acid, position 229 is a valine, position 254 is a valine, position 255 is a valine, position 371 is a valine, position 387 is a tyrosine, position 104 is an isoleucine or position 204 is a valine, This invention further provides different uses of these nucleic acid molecules. This invention also provides different sel-12 mutants and transgenic animals which carry wild-type or mutated sel-12.<H Identification, thereof, Identification, , 6787641.html, Patent, pto, 6787641

Title: Identification of sel-12 and uses thereof

Abstract: This invention provides an isolated nucleic acid molecule encoding a SEL-12. This invention further provides an isolated nucleic acid molecule which encodes a mutated SEL-12. This invention also provides an isolated nucleic acid molecule which encodes a mutated SEL-12, wherein the mutated SEL-12 contains at least one of the following: position 115 is a leucine, position 132 is an arginine, position 215 is a glutamic acid, position 229 is a valine, position 254 is a valine, position 255 is a valine, position 371 is a valine, position 387 is a tyrosine, position 104 is an isoleucine or position 204 is a valine, This invention further provides different uses of these nucleic acid molecules. This invention also provides different sel-12 mutants and transgenic animals which carry wild-type or mutated sel-12.

Patent Number: 6,787,641 Issued on 09/07/2004 to Greenwald, et al.

Inventors: Greenwald; Iva (New York, NY), Levitan; Diane (Tenafly, NJ)
Assignee: The Trustees of Columbia University in the City of New York (New York, NY)

Appl. No.: 09/043,944

Filed: October 6, 2000

PCT Filed: September 27, 1996

PCT No.: PCT/US96/15727

PCT Pub. No.: WO97/11956

PCT Pub. Date: April 03, 1997

Current U.S. Class: 536/23.1 ; 424/93.6; 424/93.7; 435/252.3; 435/320.1; 435/325; 435/348; 435/455; 435/471; 435/69.1; 530/350

Field of Search: 536/23.1 530/350 514/2,44 435/69.1,320.1,252.3,325,440,455,471 424/93.6,93.7

References Cited [Referenced By]

U.S. Patent Documents


5840540	November 1998	St. George-Hyslop et al.
5986054	November 1999	St. George-Hyslop et al.
6087153	July 2000	Greenwald et al.
6376239	April 2002	Baumeister

Other References

Daigle I., and Li C., "apl-1, a Caenorhabditis elegans gene encoding a protein related to the human beta-amyloid protein precursor" Proc. Natl. Acad. Sci. U.S.A. (1993) 90(24):12045-9 (Exhibit 4). .
Database dbEST, National Center for Biotechnology Information, National Library of Medicine, GenBank Accession No. H19012 (1995) (Exhibit 5). .
Database EMBL Accession No. U35660 (1995) Levitan D., Greenwald I., "Caenorhabditis elegans membrane protein (sel-12) mRNA " XPoo2176178 (Exhibit 6). .
Fire A., et al., "A modular set of lacz fusion vectors for studying gene expression in Caenorhabditis elegans" Gene (1990) 93(2):189-98 (Exhibit 7). .
Fitgerald K., and Greenwald I., "Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signalling activity of their extracellular domains in vivo" Development (1995) 121(12):4275-82 (Exhibit 8). .
Greenwald I., "Structure/function studies of lin-12/Notch proteins" Curr. Opin. Genet. Dev. (1994) 4(4):556-62 (Exhibit 9). .
Hedegecock E. M. and Herman R. K., "The ncl-1 gene and genetic mosaics of Caenorhabditis elegans" Genetics (1995) 141 (3):989-1006 (Exhibit 10). .
Hedgecock E. M., et al., "Genetics of cell and axon migrations in Caenorhabditis elegans" Development (1987) 100 (3): 365-82 (Exhibit 11). .
Levitan D. and Greenwald I., "Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene" Nature (1995) 377 (6547): 351-4 (Exhibit 12). .
Levy-Lahad E., et al., "Genomic structure and expression of SSTM2, the chromosome 1 familial Alzheimer disease gene" Genomics (1996) 34(2):198-204 (Exhibit 13). .
Li X. and Greenwald I., "HOP-1, a Caenorhabditis elegans presenilin, appears to be functionally redundant with SEL-12 presenilin and to facilitate LIN-12 and GLP-1 signaling " Proc. Natl. Acad. Sci. U.S.A. (1997) 94(22):12204-9 (Exhibit 14). .
Rogaev E. I., et al., "Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene" Nature (1995) 376(6543):775-8 (Exhibit 15). .
Sherrington R., et al., "Cloning of a gene bearing missense mutations in early-onset familial alzheimer's disease" Nature (1995) 375(6534):754-60 (Exhibit 16). .
Stratagene Cloning Systems Catalog, 1993 pp. 27, 31, 32, and 313 (Exhibit 17). .
Sundaram M. and Greenwald I., "Genetic and phenotypic studies of hypomorphic lin-12 mutants in Caenorhabditis elegans" Genetics (1993) 135(3):755-63 (Exhibit 18). .
Sundaram M. and Greenwald I., "Suppressors of a lin-12 hypomorph define genes that interact with both lin-12 and glp-1 in Caenorhabditis elegans" Genetics (1993) 135(3):765-83 (Exhibit 19). .
Wen C., et al., "spr-2, a suppressor of the egg-laying defect caused by loss of sel-12 presenilin in Caenorhabditis elegans, is a member of the SET protein subfamily" Proc. Natl. Acad. Sci. U.S.A. (2000) 97(26):14524-9 (Exhibit 20). .
Wilkinson H. A. and Greenwald I., "Spatial and temporal patterns of lin-12 expression during C. elegans hermaphrodite development" Genetics 1995 141(2):513-26 (Exhibit 21); and. .
Wilkinson H. A., et al., "Reciprocal changes in expresssion of the receptro lin-12 and its ligand lag-2 prior to commitment in a C. elegans cell fate decsion" Cell (1994) 79(7):1187-98 (Exhibit 22). .
Brenner S., "The genetics of Caenorhabditis elegans", Genetics. (1974) 77(1):71-94 (Exhibit 1). .
Levy-Lahad E., et al., "Candidate gene for the chromosome 1 familial Alzheimer's disease locus" Science (1995) 269 (5226):973-7 (Exhibit 2). .
L'Hernault S. W. and Arduengo P. M., "Mutation of a putative sperm membrane protein in Caenorhabditis elegans prevents sperm differentiation but not its associated meiotic divisions" J. Cell. Biol. (1992) 119(1):55-68 (Exhibit 3). .
Mello C. C., et al., "Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences" EMBO. J. (1991) 10(12): 3959-70 (Exhibit 4). .
Struhl G., et al., "Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo" Cell (1993) 74(2):331-45 (Exhibit 5). .
European Search Report, dated Nov. 20, 2002 (Exhibit 2). .
PCT International Search Report, dated Jan. 21, 1997 (Exhibit 3). .
PCT Written Opinion, dated Jul. 15, 1997 (Exhibit 4). .
Data Base Search, total of 3 pages (Exhibit 5). .
Bai, C. et al., "SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box," Cell 86:263-74 (1996) (Exhibit 6). .
Ellisen, L. W. et al., "TAN-1, the human homolog of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms," Cell 66:649-61 (1991) (Exhibit 7). .
Gallahan, D. and Callahan, P., "Mammary tumorigneesis in feral mice: identification of a new int locus in mouse mammary tumor virus (Czech II)--induced mammary tumors," J. Virol. 61:66-74 (1987) (Exhibit 8). .
Grant, B. and Greenwald, I., "Structure, function and expression of SEL-1, a negative regulatro of LIN-2 and GLP-in C. elegans," Development 124:637-644 (1997). .
Greenwald, I. et al., "The lin-12 locus specifies cell fates in C. elegans," Cell 34:435-44 (1983) (Exhibit 10). .
Greenwald, I. and Seydoux, G., "Analysis of gain-of-function mutaitons of the lin-2 gene of C. elegans," Nature 346:197-99 (1990) (Exhibit 11). .
Hubbard, J. et al., "Sel-10 negative regulator of lin-12 activity in C. elegans, encodes a member of the CDC4 family of proteins," Genes Dev. 11:3182-93 (1997) (Exhibit 12). .
Kimble, J., "Alteration in cell lineage following laser ablation of cells in the somatic gonad of C. elegans," Dev. Biol. 87:286-300 (1981) (Exhibit 13). .
King, R.W. et al, "How proteolysi drives the cell cycle," Science 274:1652-58 (1996) (Exhibit 14). .
Neer, E.J. et al., "The ancient regulatory-protein family of WD-repeat proteins," Nature 371:296-300 (1994). .
Robbins, J. et al. "Mouse mammary tumor gen int-3: a member of the Notch gene family transforms mammary epithelial cellls," J. Virol. 66:2594-99 (1992) (Exihibit 16). .
Seydoux, G. and Greenwald, I., "Cell autonomy of lin-12 function in a cell fate decision in C. elegnas," Cell 57:1237-45 (1989) (Exhibit 17). .
Shen, J. et al, "Skeletal and CNS defects in presenilin-1-deficient mice," Cell 89:629-39 (1997) (Exhibit 18). .
Sherrington, R. et al., "Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease," Nature 375:754-60 (1995) (Exhibit 19). .
Sundaram, M. and Greenwald, I., "Genetic and phenotypic studies of hypomorphic lin-12 mutants in C. elegans," Genetics 135:755-63 (1993) (Exhibit 20). .
Tuck, S. and Greenwald, I., "Lin-25, a gene required for vulval induction in C. elegans," Gmes Dev. 9:341-57 (1995) (Exhibit 21). .
Wilson, R. et al., "2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans," Nature 368:32-38 (1994) (Exhibit 22). .
Wong, P.C. et al., "Presenilin-1 is required for Notchl and DII 1 expression in the paraxial mesoderm," Nature 387:288-91 (1997) (Exhibit 23); and. .
Yochem, J. and Byers, B., "Structural comparison of the yeast cell division cycle gene CDC4 and a related pseudogene," J. Mol. Biol. 195:233-45 (1987) (Exhibit 24)..

Primary Examiner: Wax; Robert A.
Assistant Examiner: Liu; Samuel W.
Attorney, Agent or Firm: White; John P. Cooper & Dunham LLP

Parent Case Text

This application claims benefit of U.S. Provisional Application No. 60/004,387, filed Sep. 27, 1995, the content of which is incorporated into this application by reference. Within this application, publications are referenced within parentheses. Full citations for these references may be found at the end of each series of experiments. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

Claims

What is claimed is:

1. An isolated polynucleotide encoding a SEL-12, whose amino acid sequence comprises SEQ ID NO:1.

2. An isolated polynucleotide encoding SEL-12 having a mutation therein, consisting of an amino acid substitution selected from the group consisting of: a leucine at position 115, an arginine at position 132, a glutamic acid at position 215, a tyrosine at position 387, or an isoleucine at position 104, which position numbers correspond to the position numbers of SEQ ID NO:1.

3. An isolated polynucleotide encoding SEL-12 having therein a mutation selected from the group consisting of a valine substitution at position 229, 254, 255, 371, or 204, which position numbers correspond to the position numbers of SEQ ID NO:1.

4. The polynucleotide of claim 2 or 3, wherein the mutation causes a reduction or elimination of SEL-12 activity.

5. An isolated polynucleotide of claim 1, 2, or 3 wherein said polynucleotide is DNA.

6. An isolated polynucleotide of claim 1, 2, or 3 wherein said polynucleotide is cDNA.

7. A vector which comprises the polynucleotide of claim 1, 2 or 3.

8. The vector of claim 7, wherein the polynucleotide is operatively linked to a promoter of RNA transcription.

9. The vector of claim 7, wherein the vector is a plasmid.

10. The plasmid designated pMX8, deposited with the American Type Culture Collection under Designation No. 97278.

11. The plasmid designated p1-1E, deposited with the,American Type Culture Collection under Designation No. 97279.

12. A host cell-vector combination system for the production of a SEL-12 protein which comprises the vector of claim 7 and a suitable host cell.

13. The host-cell vector combination of claim 12, wherein the suitable host cell is a bacterial cell, an insect cell, a plant cell or a mammalian cell.

Description

BACKGROUND OF THE INVENTION

The lin-12 gene of C. elegans is the archetype of the, "lin-12/Notch" gene family found throughout the animal kingdom (reviewed in Greenwald and Rubin, 1992). Members of this family appear to function as receptors for intercellular signals that specify cell fates during development. Essentially, lin-12 activity controls binary decisions: if a cell has a choice between two fates, A and B, activation of lin-12 above a threshold value causes the cell to adopt fate A, whereas the failure to activate lin-12 above the threshold causes the cell to adopt fate B (Greenwald et al. 1983). Furthermore, inappropriate activation of mammalian lin-12/Notch genes have been implicated in oncogenesis (Ellisen et al., 1991; Robbins et al., 1993) and in normal development (e.g. Swiatek et al., 1993). Much of the work in applicants, laboratory is focused on understanding how lin-12 specifies cell fates. An important component of this endeavor is the identification of genes that influence lin-12 activity and the identification of potential "downstream" genes.

Applicants identified the sel-12 gene by screening for suppressors of the "Multivulva" phenotype caused by an allele of lin-12 that causes constitutive LIN-12 activation. Applicants performed a genetic and molecular characterization of sel-12, which established: (1) Reducing or eliminating sel-12 activity reduces the activity of lin-12 and of glp-1, another member of the lin-22/Notch family. In addition, reducing or eliminating sel-12 activity causes and egg-laying defective (Egl) phenotype. Applicants do not know if the Egl phenotype is a direct consequence of reducing lin-12 activity or an independent effect of reducing sel-12 activity. (2) sel-12 and lin-12 can functionally interact within the same cell. (3) sel-12 is predicted to encode a protein with multiple transmembrane domains that is highly similar to S182, which has been implicated in early-onset familial Alzheimer's disease (Sherrington et al., 1995). These findings have been described in a paper that has been accepted by Nature (Levitan and Greenwald, 1995). In addition, applicants have data indicating that sel-12 is more broadly expressed than lin-12, including a lot of expression in neurons.

The remarkable conservation of the SEL-12 and S182 predicted protein structure suggests that their functions are likely to be conserved as well. Recently, a second gene known as E5-1 or STM2 has been implicated in early-onset familial Alzheimer's disease (Levy-Lahad et al, 1995; Rogaev et al, 1995) E5-1/STM2 encodes a protein that is highly similar to S182 (Levy-Lahad et al, 1995b; Rogaev et al, 1995) and SEL-12. Furthermore, it is striking that four of the five changes in S182 or E5-1/STM2 associated with early-onset familial Alzheimer's disease alter amino acids that are absolutely conserved in the worm and the human proteins, and that the tenth alters an amino acid that has been changed very conservatively during evolution. Applicants hope to bring the powerful tools of classical and molecular genetic studies in C. elegans to bear on fundamental issues of SEL-12/S182/E5-1 structure and function. Thus, far, proteins similar to LIN-12 and SEL-12 have not been described in single-celled organisms, so C. elegans may be the simplest practical system for studying these issues in vivo.

SUMMARY OF THE INVENTION

This invention provides an isolated nucleic acid molecule encoding a SEL-12 protein. This invention further provides an isolated nucleic acid molecule which encodes a mutated SEL-12 protein. This invention also provides an isolated nucleic acid molecule which encodes a mutated SEL-12, wherein the mutated SEL-12 contains at least one of the following: position 115 is a leucine, position 132 is an arginine, position 215 is a glutamic acid, position 229 is a valine, position 254 is a valine, position 255 is a valine, position 371 is a valine, position 387 is tyrosine, position 104 is an isoleucine or position 204 is a valine. This invention further provides different uses of these nucleic acid molecules. This invention also provides different sel-12 mutants and transgenic animals which carry wild-type or mutated sel-12.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: A. Nucleotide sequence and the deduced amino acid sequence of the sel-12 cDNA. The first 22 nucleotides, shown in italics, correspond to the sequence of the trans-spliced leader SL1, a sequence found on the 5' end of many C. elegans transcripts 26. Potential membrane-spanning domains are underlined. No potential signal sequence was identified. Analysis of the amino acid sequence using the Kyte-Doolittle algorithm predicts that all nine domains have high enough hydrophobicity values to span a membrane. Three potential glycosylation sites (N-X-T/S) in the region between the seventh and eighth putative transmembrane domains are shown in italics at positions 273, 286, and 319 of the amino acid sequence. The locations of the introns are indicated by a caret over the nucleotide preceding the intron. sel-12 contains seven exons and six introns and spans 2.3 kb of genomic DNA.

B. Schematic representation of the SEL-12 protein and molecular lesions associated with three sel-12 alleles. Filled rectangles indicate nine hydrophobic regions. Based on the Kyte-Doolittle algorithm, they are potential membrane spanning domains. The fifth hydrophobic region contains only 18 amino acids and the sixth hydrophobic region contains a charged residue; however, these features are conserved in S182, so applicants infer that they are likely to be bona fide membrane-spanning domains. The ninth hydrophobic domain is not followed by a basic amino acid and is not conserved in S182 (although the C-terminus of S182 is relatively hydrophobic), so the inference that it is a membrane-spanning domain is more tentative. No potential signal sequence was identified.

FIG. 2: Predicted protein sequence of SEL-12 and its alignment with the predicted protein sequences of S182 and E5-1/STM2. The Pileup program of the GCG-Wisconsin package was used to create this alignment. Amino acids that are identical between SEL-12 and one or more of the other proteins are highlighted in black, and predicted transmembrane domains are overlined. S182 is the predicted protein of a gene associate with early-onset familial Alzheimer's disease (Sherrington et al., 1995). E5-STM2 has also been implicated in early-onset familial Alzheimer's disease (Levy-Lahad et al., 1995a,b; Rogaev et al., 1995). The positions of the ten mutations associated with disease in S182 and E5-1/STM2 (Levy-Lahad et al., 1995b; Rogaev et al., 1995; Sherrington et al., 1995) are indicated (X), and tabulated in Table 1 below. SEL-12 and S182 are 48% identical, SEL-12 and E5-1/STM2 are 51% identical, and S182 and E-51/STM2 are 67% identical (Levy-Lahad et al., 1995b; Rogaev et al., 1995). SPE-4 is the predicated protein of the spe-4 gene of C. elegans, which is required for spermatogenesis (L'Hernault and Arduengo, 1992). SEL-12, S182 and E5-1/STM2 appear to be much more closely related to each other than they are to SPE-4. For example, S182 and SPE-4 are only 22% identical, with several large gaps. Furthermore, several regions that are very highly conserved between SEL-12, S182 and E5-1/STM2 are not conserved in SPE-4, and only one of the ten mutations associated with Alzheimer,s disease affects an amino acid that is identical in SPE-4.

FIG. 3. Transgenic hermaphrodites expressing a sel-12::lacZ transgene. Expression is seen in neural and non-neural cells. A. Adult. Large arrow indicates nerve ring; smaller arrows indicate muscle nuclei. B. Adult. Arrows indicate ventral cord nuclei. C. L3 larva. Arrows indicate nuclei of the vulval precursor cells P3.p-P8.p. D. L2 larva. Arrows indicate the nuclei of the somatic gonadal cells Z1.ppp and Z4.aaa. sel-12 activity has been shown to influence the fates of P3.p-P8.p, and Z1.ppp and Z4.aaa in sensitized genetic backgrounds (11 of the Third Series of Experiments). Compromised neural function associated with reduced activity has not yet been seen in the nerve ring or ventral cord, possibly because an appropriate sensitized genetic background has not been examined. Complete genotype: smg-1(r861) unc-54(r293); arIs17 [pRF4, pIB1Z17].

DETAILED DESCRIPTION OF THE INVENTION

This invention provides an isolated nucleic acid molecule encoding a SEL-12. This invention further provides an isolated nucleic acid molecule which encodes a mutated SEL-12. This invention also provides an isolated nucleic acid molecule which encodes a mutated SEL-12, wherein the mutated SEL-12 contains at least one of the following: position 115 is a leucine, position 132 is an arginine, position 215 is a glutamic acid, position 229 is a valine, position 254 is a valine, position 255 is a valine, position 371 is a valine, position 387 is tyrosine, position 104 is an isoleucine or position 204 is a valine. In an embodiment, the mutation is generated by in vitro mutagenesis.

In an embodiment, the isolated nucleic acid molecule is a DNA molecule. In a further embodiment, the DNA is a cDNA molecule. In another further embodiment, the DNA is a genomic DNA molecule. In a separate embodiment, the nucleic acid molecule is an isolated RNA molecule.

This invention also provides the above nucleic acid molecule which encodes substantially the same amino acid sequence as shown in FIG. 1A.

This invention also provides a nucleic acid molecule of at least 15 nucleotide capable of specifically hybridizing with a unique sequence within the sequence of a nucleic acid molecule described above. In an embodiment, these nucleotide are DNA. In another embodiment, these nucleotide are RNA.

This invention also provides a vector which comprises the above-described isolated nucleic acid molecule. This invention also provides the above-described isolated nucleic acid molecules operatively linked to a promoter of RNA transcription.

In an embodiment, the vector is a plasmid. In an embodiment, the Sel-12 genomic DNA, a MunI/XhoI genomic fragment was cloned into the Bluescript KS.sup.+ plasmid which was cut with EcoRI and XhoI. The resulting plasmid is designated as PMXB.

The plasmids designated pMX8 and p1-1E were deposited on Sep. 14, 1995, pursuant to the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209, under ATCC Designation Nos. 97278, and 97279, respectively. During the pendency of the subject application, access to the deposit shall be afforded to the Commissioner upon request. All restrictions upon public access to this deposit shall be removed upon the grant of a patent on this application and the deposits shall be replaced if viable samples cannot be made by the depository named hereinabove.

This plasmid, pMX8 was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. on Sep. 14, 1995 under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. The pMX8 was accorded with ATCC Accession number 97278.

In another embodiment, a Sel-12 cDNA, an EcoRI cDNA fragment was cloned into the Bluescript KS.sup.+ plasmid which is cut with EcoRI. The resulting plasmid is designated p1-1E. The plasmid, p1-1E was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. on Sep. 14, 1995 under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. The p1-1E was accorded with ATCC Accession number 97279. This plasmid p1-1E containing a frameshift mutation in the 3' end of the coding region of the cDNA. It can be easily corrected to the wild-type sequence as the complete sequence of Caenorhabditis elegans has been known.

This invention also provides a host vector system for the production of a polypeptide having the biological activity of a SEL-12 or a mutated SEL-12 which comprises the above-described vector and a suitable host. The suitable hosts include but are not limited to bacterial cells, insect cells, plant and mammalian cells.

This invention also provides purified SEL-12 and mutated SEL-12.

This invention also provides a purified SEL-12 protein or a purified SEL-12 fragment thereof. This invention further provides a purified mutated SEL-12 protein or a purified mutated SEL-12 fragment thereof.

This invention provides a method for production of an antibody capable of binding to wild-type and/or mutant S182 or E5-1/STM2 comprising: a) administering an amount of the purified protein or fragment of SEL-12 or mutated SEL-12 to a suitable animal effective to produce an antibody against SEL-12 or mutated SEL-12 protein in the animal; and b) testing the produced antibody for capability to bind wild-type and/or mutant S182 or E5-1/STM2.

In an embodiment, the antibody is produced by in vitro immunization. In another embodiment, the antibody is produced by screening a differential phage display library. The produced antibody may be tested by Western blot analysis, immunoprecipitation, staining of cells or tissue sections or in combination of the above.

This invention also provides a method for production of an antibody capable of binding to wild-type and/or mutant S182 or E5-1/STM2 comprising: a) determining conserved regions revealed by alignment of the SEL-12, S182 and E5-1/STM2 protein sequences; b) synthesizing peptides corresponding to the revealed conserved regions; c) administering an amount of the synthesized peptides to a suitable animal effective to produce an antibody against the peptides in the animal; and b) testing the produced antibody for capability to bind wild-type and/or mutant S182 or E5-1/STM2.

In an embodiment, the antibody is produced by in vitro immunization. In another embodiment, the antibody is produced by screening a differential phage display library. The produced antibody may be tested by Western blot analysis, immunoprecipitation, staining of cells or tissue sections or in combination of the above.

This invention provides antibodies produced by above methods. This invention intends to cover other methods of production of antibodies capable of binding to wild-type and/or mutant S182 or E5-1/STM2 using the SEL-12 protein or sel-12. This invention also provides monoclonal antibodies capable of binding to wild-type and/or mutant S182 or E5-1/STM2.

This invention also provides antibodies capable of specifically recognizing SEL-12 protein or mutated SEL-12 protein. As used herein the term "specifically recognizing" means that the antibodies are capable of distinguish SEL-12 protein or mutated SEL-12 proteins from other proteins.

This invention also provides transgenic animals which express the above nucleic acid molecules. In an embodiment, the animal is a Caenorhabditis elegans. This invention also provides transgenic Caenorhabditis elegans animals comprising wild-type or mutant human S182 gene. This invention further provides transgenic Caenorhabditis elegans animals comprising wild-type or mutant human STM2/E5-1 gene.

This invention provides the above transgenic Caenorhabditis elegans animals, wherein the wild-type or mutant human S182, or wild-type or mutant STM2/E5-1 gene is under the control of sel-12 or lin-12 regulatory sequence.

This invention also provides a method for identifying a compound which is capable of ameliorating Alzheimer disease comprising administering effective amount of the compound to the transgenic animals or sel-12 mutants, the alteration of the conditions of the transgenic animal indicating the compound is capable of ameliorating Alzheimer disease.

This invention also provides a previously unknown compound identified by the above method. This invention provides a pharmaceutical composition comprising an effective amount of the compound identified by the above method and a pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers are well known to those skilled in the art. Such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.

This invention further provides a method for determining whether a compound might be capable of ameliorating Alzheimer's disease comprising: a) treating Caenorhabditis elegans mutants having reduced, increased or altered sel-12 activity with the compound; and b) determining whether the compound suppresses, enhances or has no effect on the phenotype of the mutant, the suppression or enhancement of the phenotype indicating the compound is capable of ameliorating Alzheimer's disease.

This invention provides a pharmaceutical composition comprising an effective amount of the compound determined by the above method to be capable of ameliorating Alzheimer's disease and a pharmaceutically acceptable carrier.

This invention provides a method for identifying a suppressor of the multivulva phenotype of lin-12 gain-of-function mutation comprising: a) mutagenizing lin-12 Caenorhabditis elegans worms with an effective amount of an appropriate mutagen; b) screening for revertants in the F1, F2 and F3 generations; and c) isolating the screened revertant, thereby identifying a suppressor of the multivulva phenotype of lin-12. This invention also provides suppressors identified by the above method.

In an embodiment, this invention provides a Caenorhabditis elegans animal having a suppressor, designated sel-12(ar131). This nematode was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. on Sep. 27, 1995 under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. sel-12(ar131) was accorded with ATCC Accession number 97293. In another embodiment, this invention provides an animal having a suppressor designated sel-12(ar133).

This invention also provides a method for identifying a mutant sel-12 gene which reduces sel-12 function comprising: a) mutagenizing Caenorhabditis elegans worms with an effective amount of an appropriate mutagen; b) performing complementation screening of the mutagenized worms to determine if a descendant of a mutagenized worm bears a mutation that fails to complement one of the above-described suppressor for the Egl defect; and c) isolating the individual worm and determining the phenotype of worms carrying the new allele in its homozygous form and in trans to a deficiency, thereby identifying a mutant sel-12 gene which reduces sel-12 function. In an embodiment, this invention provides the above method which further comprises performing DNA sequence analysis of the identified mutant sel-12 gene to determine the molecular lesion responsible for the mutation.

This invention also provides mutant sel-12 genes identified by the above methods. In an embodiment, this invention provides an animal having a mutant sel-12 gene, designated sel-12 (ar171). This nematode was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. on Sep. 27, 1995 under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. sel-12(ar171) was accorded with ATCC Accession number 97292.

This invention provides a method for producing extragenic suppressors of a sel-12 allele comprising: a) mutagenizing sel-12 mutant hermaphrodites with an effective amount of a mutagen; b) screening for revertants in the F1, F2 and F3 generations; and c) isolating the screened revertant.

This invention also provides a method for producing extragenic suppressors of a sel-12(Alz) mutant comprising: a) mutagenizing sel-12 (Alz) hermaphrodites with an effective amount of a mutagen; b) screening for revertants in the F1, F2 and F3 generations; and c) isolating the screened revertant.

Appropriate mutagens which may be used in this invention are well known in the art. In an embodiment, the mutagen is ethyl methanesulfonate.

This invention also provides suppressors produced by the above methods. This invention further provides a method for identification of a suppressor gene comprising performing DNA sequence analysis of the above suppressors to identify the suppressor gene. This invention also provides the identified suppressor gene by the above method.

This invention will be better understood from the examples which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

Experimental Details

First Series of Experiments

Materials and Methods

Applicants genetically mapped sel-12 to the left of unc-1 X: from hermaphrodites of genotype sel-12(ar131) dpy-3(e27)/unc-1(e538), 1/36 Sel non-Dpy and 18/19 Dpy non-Sel recombinants segregated unc-1. To clone se1-12, applicants used the well correlated genetic and physical maps in the sel-12 region to identify cosmid clones that potentially carried the sel-12 gene (ref. 27 and A. Coulson et al., personal communication). Applicants assayed pools and single cosmids for the ability to rescue the Egl defect of sel-12 (ar131) hermaphrodites, using the plasmid pRF4 [rol-6 (su1006)] as a dominant cotransformation marker (28). Ultimately, applicants found that pSpX4, containing a 3.5 kb_SpeI/+XhoI subclone of C08A12 (Subcloned into KS Bluescript, Stratagene) completely rescue sel-12(ar131). When this subclone was microinjected at a concentration of 10 .mu.g/ml into sel-12(ar131) animals, 6/6 lines all demonstrated rescue of the Egl phenotype. When applicants attempted to obtain transgenic lines carrying pSpX4 using a concentration of 50 .mu.g/ml, applicants obtained F1 transformants but no stable lines perhaps indicating some toxicity of this plasmid at higher concentrations. Applicants used this genomic subclone to screen a cDNA library and identified one class of clones of 1.5 kb in size. All subcloning, restriction digests, and library screening were done according to standard techniques (29). Applicants sequenced both strands of the cDNA clone after generating systematic deletions using the Erase-a-base system (Promega.RTM.). DNA sequence was performed on double stranded templates using Sequenase.TM. (US Biochemical). The cDNA contained both a poly (A) tail and a portion of the spliced leader sequence SL1 (ref. 30), suggesting it was a full length clone. Applicants confirmed the 5' end of the cDNA by reverse transcription followed by polymerase chain reaction (RT-PCR) (31). The sequence of this full-length cDNA can be found through GenBank under accession number U35660.

To identify the lesions associated with sel-12 alleles applicants used PCR to amplify the sel-12 genomic fragment from DNA isolated from the sel-12 mutant strains using the primers DL103 (5' TGTCTGAGTTACTAGTTTTCC 3') (SEQ. ID. NO:7) and DLG3 (5' GGAATCTGAAGCACCTGTAAGCAT 3') (SEQ. ID. NO:8). An aliquot of this double-stranded amplification product was used as the template in a subsequent round of PCR using only the primer DL103, to generate a single-stranded template. Exon specific primers were used to determine the entire coding sequence for all three alleles. For each allele, only one alteration in sequence was identified.

Experimental Result and Discussion

The lin-12(d) hypermorphic mutation lin-12(n950) causes a Multivulva phenotype characterized by the production of ectopic pseudovulvae (3, 4). Applicants screened for non-Multivulva revertants after ethyl methanesulfonate mutagenesis (5) of lin-12(n950) hermaphrodites; two recessive suppressors, ar132 and ar133, proved to be alleles of a new gene, sel-12 (sel means suppressor and/or enhancer of lin-12). These sel-12 alleles cause an incompletely penetrant, recessive egg-laying defective (Egl) phenotype in a lin-12(+) background. Since sel-12(ar131) is viable, fertile and Egl in trans to a deficiency (data not shown), applicants also performed a screen for mutations that fail to complement the Egl defect of sel-12(ar131). From a screen of 5900 mutagenized haploid genomes, applicants identified two additional sel-12 alleles. One allele obtained in this screen, sel-12(ar171), displays a completely penetrant Egl defect as a homozygote and in trans to a deficiency, suggesting that sel-12(ar171) strongly reduces sel-12 function. This inference is supported by the molecular analysis described below, which revealed that the ar17l lesion would result in a truncated protein product.

The Egl phenotype caused by sel-12 mutations in a lin-12(+) background is reminiscent of the Egl phenotype caused by reducing lin-12 activity (see Table 1 legend). However, a more general involvement of sel-12 in lin-12- and glp-1-mediated cell fate decisions becomes apparent when the phenotypes of lin-12; sel-12 and glp-1; sel-12 double mutants are analyzed (Table 1). Applicants examined the genetic interactions of sel-12 with two lin-12 hypomorphic mutations, with a lin-12(d) hypermorphic mutation, and with a glp-1 hypomorphic mutation. In all cases, applicants found that reducing sel-12 activity reduces lin-22 or glp-1 activity. These genetic interactions are exemplified by the effects of sel-12 on two lin-12-mediated decisions, the anchor cell/ventral uterine precursor cell (AC/VU) decision and vulval precursor cell (VPC) specification.

The AC/VU decision involves an interaction between two initially equivalent cells of the somatic gonad, Z1.ppp and Z4.aaa. In a given hermaphrodite, Z1.ppp and Z4.aaa interact so that one of these cells becomes the AC while the other becomes a VU (6, 7, 8). When lin-12 activity is eliminated, both Z1.ppp and Z4.aaa become ACs (the "2 AC defect"), and when LIN-12 is activated, as in lin-12(d) mutants, both Z1.ppp and Z4.aaa become VUs (the "0 AC defect") (3,9). Two observations indicate that sel-12 reduces lin-12 activity in Z1.ppp and Z4.aaa. First, sel-12 dramatically enhances the penetrance of the 2 AC defect of lin-12 hypomorphs (Table 1A). For example, 30% of lin-12 (n676n930) hermaphrodites have 2 AC (10), whereas essentially all lin-12(n676n930); sel-12(ar171) have 2 ACs. Second, sel-12 partially suppresses the 0 AC defect caused by LIN-12 activation (Table 1B). For example, all lin-12(n950) hermaphrodites lack an AC, whereas 10% of lin-12(n950); sel-12(ar171) hermaphrodites have an AC.

TABLE 1 sel-12(ar171) reduces lin-12 and glp-1 activity % ventral fer- % L1 Genotype % 2ACs coelomocytes tility arrest.sup.k A. Enhancement of hypomorphic lin-12 alleles by sel-12 (ar171) wild type.sup.a 0 0 yes 0 sel-12(ar171).sup.b 0 0 (0/17) yes 0 (n = 233) lin-12 30 g 8 (1/12) yes 9 (n = 233) (n676n930).sup.c lin-12 95 (n = 41) 92 (12/13) no 17 (n = 177) (n676n930); sel-12(ar171).sup.d lin-12(ar170).sup.e 16 (n = 32) 0 (0/32) yes 0 (n = 209).sup.i lin-12(ar170); 98 (n = 47) 0 (0/47) yes 0 (n = 111) sel-12(ar171).sup.f lin-12(O) 100.sup.h 100.sup.h no 10.sup.j number of VPCs adopting a vulval fate/ Genotype hermaphrodite % 0 AC B. Suppression of a hypermorphic lin-12 allele by sel-12(ar171) wild type.sup.a 3 0 lin-12(n950).sup.l 6 (n = 7) 100 sel-12(ar171).sup.b 3 (n = 10) 0 (n = 108) lin-12(n950); sel-12(ar171).sup.m 2-4 (n = 8) 89.5 (n = 57) % sterility in both % sterility in Genotype gonad arms one gonad arm C. Enhancement of glp-1(e2141) by sel-12(ar171) wild type.sup.a 0 0 glp-1(e2141).sup.n 8.5 (n = 259) 4.0 (n = 259) sel-12(ar171).sup.b 0 0 glp-1(e2141); 25 (n = 422) 8.8 (n = 422) sel-12(ar17).sup.o .sup.a C. elegans var. Bristol strain N2 .sup.b sel-12(ar171) unc-1(e538) .sup.c lin-12(n676n930); unc-1(e538) .sup.d lin-12(n676n930); sel-12(ar171) unc-1(e538) .sup.e lin-12(ar170); unc-1(e538) .sup.f lin-12(ar170); sel-12(ar171) unc-1(538) .sup.g see ref. 10 .sup.h lin-12(n137n720); see ref. 3 .sup.i lin-12(ar170) [not unc-1] .sup.j lin-12(n941) see ref. 23 .sup.k some L1 arrested animals were examined for Lag phenotypes, i.e. lack of an anus and rectum, lack of an excretory cell and a twisted nose. These phenotypes were observed for all genotypes where L1 arrested animals were identified. .sup.l lin-22(n950); unc-1(e538) .sup.m lin-12(n950); sel-12(ar171) unc-1(e538) .sup.n glp-1(e2141); unc-1(e538) .sup.o glp-1(e2141; sel-12(ar171) unc-1(e538)

Table 1. Legend

Most lin-12- and glp-1-mediated cell fate decisions appear normal in sel-12(ar171) mutants. However, the egg-laying defect of sel-12(ar171) hermaphrodites resembles the egg-laying defect of lin-12 hypomorphic mutants (10): sel-12(ar131) hermaphrodites leak occasional eggs and larvae, and like lin-12 hypomorphic mutants, sel-12 mutants have morphologically normal HSNs, sex muscles and VPC lineages. Egg-laying is particularly sensitive to reduction in lin-12 activity (10); H. Wilkinson and I. G., unpublished observations). It is therefore possible that both lin-12 and sel-12 are required for an as yet unidentified cell fate decisions) underlying the egg-laying defect. The fact that sel-12(ar171) mutants do not display all of the defects associated with loss of lin-12 function may indicate that sel-12(ar171) is not a null allele or sel-12 function is partially redundant with the function of another gene.

A. Cell fate transformations were scored at 25.degree. using criteria described in (3) unless otherwise indicated. At 25.degree. lin-12(n676n930) behaves like a hypomorph, whereas at 15.degree. C., lin-12(n676n930) has mildly elevated lin-12 activity (10). Since lin-12(n676n930); sel-12(ar171) hermaphrodites are sterile at 25.degree. C., applicants shifted fertile lin-12(n676n930); sel-12(ar171) hermaphrodites from 15.degree. C. to 25.degree. C. so that their progeny could be scored for cell fate transformations and other defects. lin-12(ar170) behaves like a hypomorph for the,AC/VU decision (J. Hubbard and I. G., unpublished observations). In strains containing lin-12(ar170), cell fate transformations were scored in hermaphrodites raised at 20.degree.; other defects were scored in the progeny of hermaphrodites grown at 20.degree. and shifted to 25.degree.. % 2ACs: In lin-12(0) mutants, both Z1.ppp and Z4.aaa become ACs, so lin-12(0) hermaphrodites have two ACs; in lin-12(d) mutants such as lin-12(n950), both Z1.ppp and Z4.aaa become VUs, so lin-12(d) hermaphrodites have 0 ACs. The number of anchor cells was scored in the L3 stage using Nomarski microscopy. For all genotypes, hermaphrodites either had one or two ACs. ventral coelomocytes: The fates of two pairs of cells, M.d(l/r)pa and M.v(l/r)pa are affected by mutations in lin-12. In wild type, the ventral pair of cells gives rise to one sex-myoblast and one body muscle; the dorsal pair gives rise to coelomocytes. In lin-12(0) animals, the ventral pair as well as the dorsal pair gives rise to coelomocytes, so that lin-12(0) hermaphrodites have extra ventral coelomocytes; in lin-12(d) animals, both pairs of cells give rise to sex myoblasts/body muscles. The presence of ventral coelomocytes was scored in the L3 stage. For all genotypes, the absence of ventral coelomocytes suggests that the sex myoblast was specified normally (see ref. 3). Fertility: fertility was scored by the appearance of eggs either on the plate or inside the hermaphrodite and the ability to propagate the strain.

L1 arrest: Full viability requires activity of lin-12 or a related gene, glp-1. lin-12(0) glp-1(o) double mutants display a fully penetrant L1 arrest phenotype and a Lag phenotype characterized by specific cell fate transformations (23). lin-12(0) single mutants display a low penetrance L1 arrest phenotype and a somewhat lower penetrance Lag phenotype (23). Single gravid hermaphrodites were placed on a plate at 25.degree. C. Most of the hermaphrodites were completely egg-laying defective and laid no eggs; some lin-12(n676n930) animals released a few eggs or larvae before turning into "bags of worms", in which case the hermaphrodite was transferred after a day. Since lin-12(n676n930) animals can grow slowly at 25.degree. C., L1 arrested animals were scored three days after all the eggs had hatched. Arrested L1 animals were spot-checked for the presence of Lag phenotypes using Nomarski microscopy. Some arrested L1 animals of each genotype displayed Lag phenotypes (data not shown).

B. Animals were grown at 20.degree.C. VPC fates were scored by determining the cell lineages of P3.p-PB.p in each animal (Table 2 and data not shown). The number of ACs were scored as described above. For all genotypes, hermaphrodites had either zero or one AC.

C. glp-1(e2141ts) is weakly hypomorphic at 20 and essentially wild-type at 15.degree. (24). Strains containing glp-1(e2141) were maintained at 15.degree.; fertile adults grown at 15.degree. were placed at 20.degree., and their progeny grown at 20.degree. were scored for sterility. Other strains were maintained continuously at 20.degree.. glp-1 activity controls the decision of germline nuclei between mitosis and meiosis (25, 24); L. W. Berry and T. Schedl, personal communication). GLP-1 is thought to be the receptor for the inductive signal from the distal tip cells of the somatic gonad that promotes germline mitosis (and/or inhibits meiosis) (7). When glp-1 activity is eliminated, germline nuclei enter meiosis (25). Hermaphrodites of each genotype were scored for sterility in one or both gonad arms in the dissecting microscope. Several sterile or half-sterile individuals were examined by Nomarski microscopy, and sterile gonad arms were found to have the characteristic Glp phenotype (data not shown).

Each of the six VPCs, P3.p-P8.p, has the potential to adopt one of two vulval fates, termed "1.degree." and "2.degree.", or a non-vulval fate, termed "3.degree." (11, 12). Normally, P5.p, P6.p, and P7.p adopt vulval fates, in a 2.degree.-1.degree.-2.degree. pattern (13). This pattern is the outcome of the integration of two signalling inputs: a let-60 Ras-mediated inductive signal from the AC induces vulval fates, and a lin-12-mediated lateral signal between VPCs prevents adjacent VPCs from adopting the 1.degree. fate (reviewed in ref. 14). The let-60 Ras-mediated inductive signal may cause expression or activation of the lateral signal (15, 16), which activates LIN-12 to cause a VPC to adopt the 2.degree. fate (3, 17, 18).

Reducing sel-12 activity reduces lin-12 activity in lateral signalling that specifies the 2.degree. fate of VPCs. First, sel-12 reduces the effect of activated LIN-12 in the VPCs: all VPCs adopt the 2.degree. fate in lin-12(n950) hermaphrodites, but only half of the VPCs adopt the 2.degree. fate in lin-12(n950); sel-12(ar171) hermaphrodites (Table 1b, Table 2). Second, sel-12 reduces lateral signalling that occurs upon activation of let-60 Ras. Applicants analyzed VPC lineages (data not shown) in let-60(n1046) hermaphrodites, in which Ras has been activated by a codon 13 mutation (19, 20), and in let-60(n1046); sel-12(ar171) hermaphrodites. Lateral signalling appears to occur normally in let-60(n1046) hermaphrodites, since adjacent VPCs do not adopt the 1.degree. fate (0/20 pairs of induced VPCs). In contrast, adjacent VPCs sometimes adopt the 1.degree. fate in let-60(n1046); sel-12(ar171) hermaphrodites (4/18 pairs), implying that reducing the activity of sel-12 reduces lateral signalling. Finally, some VPCs adopt the 2.degree. fate in lin-12(n676n930) hermaphrodites (10). In contrast, VPCs do not adopt the 2.degree. fate in lin-12(n676n930); sel-12(ar171) double mutants (data not shown), although applicants have not tested whether this effect is due to the presence of a second AC.

TABLE 2 sel-12(ar171) plays a role in the receiving cells % VPCs adopt- Expression of 2.degree. fate/total ing a 2.degree. fate Genotype P3.p P4.p P5.p P6.p P7.p P8.p hermaphrodite lin-12(n950) 7/7 7/7 7/7 7/7 7/7 7/7 100 lin-12(n950); 0/8 1/8 4/8* 8/8 6/8 2/8** 52 sel-12(ar171) lin-12(n-950) X 11/11 X X X X 100 lin-12(n950); X 3/10 X X X X 30 sel-12(ar171)

Table 2. Legend

X=cell killed by a laser microbeam. Numbers in each column correspond to the proportion of times a given VPC was observed to adopt the 2.degree. fate (criteria as in ref. 18). All VPCs that did not undergo 2.degree. fates underwent 3.degree., or non-vulval fates, with three exceptions: *=in 1/8 animals examined, P5.p underwent a hybrid (2.degree./3.degree.) lineage; **=in 2/8 animals examined, P8.p underwent a hybrid (2.degree./3.degree.) lineage. Animals were maintained at 20.degree. C. Early L2 hermaphrodites (as judged by the size of the gonad) were chosen for laser ablation studies. The fates of the VPCs have not been determined at this time; the VPCs become determined many hours later, in the L3 stage (Sternberg and Horvitz, 1986). P3.p, and P5.p-P8.p were destroyed with a laser microbeam; the success of this operation was verified 2-3 hours later. The following day, the operated animals were mounted for Nomarski microscopy so that the cell lineage of P4.p could be observed directly. In both operated and unoperated animals, vulval fates were scored by directly observing the cell lineage of each VPC. The operated animals were observed until the early L4 stage, to ensure that no divisions were missed.

The genetic interactions of sel-12 with lin-12 imply a function for sel-12 in signalling and/or receiving cells during lateral specification. Applicants have tested whether sel-12 functions in the receiving end of lin-12-mediated cell-cell interactions by performing cell ablation experiments (Table 2). Applicants reasoned that, if all VPCs but one were ablated with a laser microbeam, the fate of the isolated VPC would reflect its intrinsic level of lin-12 activity in the absence of lateral signal. Thus, in lin-12(n950) hermaphrodites, an isolated VPC adopts the 2.degree. fate (Table 2), suggesting that it has a high level of ligand-independent activation of LIN-12 in the VPCs (9). If sel-12 were to function in one VPC to lower lin-12 activity in another, then in lin-12(n950); sel-12(ar171) hermaphrodites, an isolated VPC should also adopt the 2.degree. fate. However, if sel-12 were to function within a VPC to lower its lin-12 activity, then in lin-12(n950); sel-12(ar171) hermaphrodites, an isolated VPC should instead adopt the 3.degree. fate. Applicants observed that in lin-12(n950); sel-12(ar171) hermaphrodites, an isolated P4.p often adopts the 3.degree. fate (Table 2), implying that sel-12 functions within a VPC to lower lin-12 activity.

Applicants cloned sel-12 by transformation rescue (FIG. 1 legend), and determined the nucleotide sequence of a full-length cDNA (Genbank Accession number U35660). The predicted SEL-12 protein contains multiple potential transmembrane domains (FIG. 1B), consistent with SEL-12 function as a receptor, ligand, channel, or membrane structural protein. The SEL-12 protein is evolutionarily conserved. Database searches revealed a high degree of similarity to a sequence of a partial cDNA from human brain present on clone T03796 and a low degree of similarity to SPE-4, a protein required for C. elegans spermatogenesis (21). In addition, SEL-12 is highly similar to S182, which, when mutant, has been implicated in familial early-onset Alzheimer's Disease (22). T03796 has recently been shown to correspond to the E5-1/STM2 gene, which has also been S implicated in early onset familial Alzheimer's disease (Levy-Lahad et al., 1995a,b; Rogaev et al., 1995). The predicted protein sequences of SEL-12, E5-1/STM2, SPE-4, and S182 are aligned in FIG. 2.

lin-12/Notch genes specify many different cell fate decisions in C. elegans and Drosophila, and in both organisms some of these decisions are critical for neurogenesis. The genetic analysis described here indicates that sel-12 facilitates lin-12-mediated reception of intercellular signals. sel-12 might be directly involved in lin-12-mediated reception, functioning for example as a co-receptor or as a downstream effector that is activated upon LIN-12 activation. Alternatively, sel-12 may be involved in a more general cellular process such as receptor localization or recycling and hence influence lin-12 activity indirectly. Although the remarkable conservation of sel-12 and S182 does not provide any immediate indication of the function of S182 in the Alzheimer's disease process, it is striking that 4 of the 5 mutations found in affected individuals alter amino acids that are identical in SEL-12 and S182 (see FIG. 2). The powerful tools of classical and molecular genetic studies in C. elegans, including the ability to identify extragenic suppressor and to generate transgenic lines containing engineered genes, can now be brought to bear on fundamental issues of SEL-12/S182 structure and function.

References of the First Series of Experiments 1. Greenwald, I. Current Opinion in Genetics and Development 4, 556-562 (1994). 2. Artavanis-Tsakonas, S., Matsuno, K. & Fortini, M. Science 268, 225-268 (1995). 3. Greenwald, I., Sternberg, P. & Horvitz, H. R. Cell 34, 435-444 (1983). 4. Ferguson, E. L. & Horvitz, H. R. Nature 110, 259-267 (1985). 5. Brenner, S. Genetics 77, 71-94 (1974). 6. Kimble, J. & Hirsh, D. Developmental Biology 81, 208-221 (1979). 7. Kimble, J. Developmental Biology 87, 286-300 (1981). 8. Seydoux, G. & Greenwald, I. Cell 57, 1237-1245 (1989). 9. Greenwald, I. & Seydoux, G. Nature 346, 197-199 (1990). 10. Sundaram, M. & Greenwald, I. Genetics 135, 755-763 (1993). 11. Sulston, J. & White, J. Developmental Biology 78, 577-597 (1980). 12. Sternberg, P. & Horvitz, H. R. Cell 44, 761-772 (1986). 13. Sulston, J. & Horvitz, H. R. Developmental Biology 56, 110-156 (1977). 14. Horvitz, H. R. & Sternberg, P. W. Nature 351, 535-541 (1991). 15. Simske, J. S. & Kim, S. K. Nature 375, 142-146 (1995). 16. Tuck, S. & Greenwald, I. Genes and Development 9, 341-357 (1995) 17. Sternberg, P. W. Nature 335, 551-554 (1988). 18. Sternberg, P. W. & Horvitz, H. R. Cell 58, 679-693 (1989). 19. Beitel, G. J., Clark, S. G. & Horvitz, H. R. Nature 348, 503-509 (1990). 20. Han, M. & Sternberg, P. W. Cell 63, 921-931 (1990). 21. L'Hernault, S. W. & Arduengo, P. M. The Journal of Cell Biology 119, 55-68 (1992). 22. Sherrington, R., et al. Nature 375, 754-760 (1995). 23. Lambie, E. & Kimble, J. Development 112, 231-240 (1991). 24. Priess, J. R., Schnabel, H. & Schnabel, R. Cell 51, 601-611 (1987). 25. Austin, J. & Kimble, J. Cell 51, 589-599 (1987). 26. Khan, A. S., et al. Nature genetics 2, 180-185 (1992). 27. Coulson, A., Waterston, J., Kiff, J., Sulston, J. & Kohara, Y. Nature 235, 184-186 (1988). 28. Mello, C. C., Kramer, J. M., Stinchcomb, D. T. & Ambros, V. A. EMBO Journal 10, 3959-3970 (1991). 29. Maniatis, T., Fritsch, E. F. & Sambrook, J. Molecular cloning: A laboratory manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1982). 30. Krause, M. & Hirsh, D. Cell 49, 753-761 (1987). 31. Ohara, O., Dorit, R. & Gilbert, W. Proceedings of the National Academy of Sciences 86, 5673-5677 (1989).

Second Series of Experiments

Background and Significance

Alzheimer's disease is a devastating and common disease of the central nervous system, and studies of familial forms have identified a number of loci that are implicated in the development of the disease. Two loci, S182 (AD3) (Sherrington et al., 1995) and STM2 (Levy-Lahad et al., 1995a,b), which is also known as E5-1 (Rogaev et al., 1995), have recently been found to be associated with the development of early onset familial Alzheimer's disease. These loci encode related proteins with multiple transmembrane domains.

The C. elegans model described here is based on the finding that the sel-12 gene encodes a protein that is highly similar to S182 and STM2 (Levitan and Greenwald, 1995; see FIG. 1). For example, SEL-12 and S182 are 48% identical over 460 amino acids. The remarkable conservation of the SEL-12 and S182 predicted protein structure suggests that their functions are likely to be conserved as well. Furthermore, it is striking that seven of the eight changes in S182 that are associated with early-onset familial Alzheimer's disease (Rogaev et al., 1995; Sherrington et al., 1995; see FIG. 1) alter amino acids that are identical in SEL-12, and that the eighth alters an amino acid that has been changed very conservatively during evolution, and two out of two changes in STM2/E5-1 that are associated with Alzheimer's disease (Levy-Lahad et al., 1995b; Rogaev et al., 1995) affect amino acids that are identical in SEL-12.

Applicants hope to bring the powerful tools of classical and molecular genetic studies in C. elegans to bear on fundamental issues of SEL-12/S182/STM2 structure and function. Thus far, proteins similar to LIN-12/Notch and SEL-12/S182/STM2 have not been described in single-celled organisms (for example, >95% of the yeast genome has been sequenced and has not yielded any similar proteins), so C. elegans may be the simplest practical system for studying these issues in vivo.

Preliminary Studies

sel-12. Applicants identified sel-12 [sel=suppressor/enhancer of lin-12] by screening for suppressors of the "Multivulva" phenotype caused by an allele of lin-12 that causes constitutive LIN-12 activation. Applicants performed a genetic and molecular characterization of sel-12 (Levitan and Greenwald, 1995), which established: (1) Reducing or eliminating sel-12 activity reduces the activity of lin-12 and of glp-1, another member of the lin-12/Notch family. In addition, reducing or eliminating sel-12 activity causes an egg-laying defective (Egl) phenotype. Applicants do not know if the Egl phenotype is a direct consequence of reducing lin-12 activity (Sundaram and Greenwald, 1993a) or an independent effect of reducing sel-12 activity. (2) sel-12 and lin-12 can functionally interact within the same cell. (3) sel-12 is predicted to encode a protein with multiple transmembrane domains that is highly similar to S182 and STM2, which have been implicated in early-onset familial Alzheimer's disease (Levy-Lahad et al., 1995a, b; Rogaev et al., 1995; Sherrington et al., 1995). The presence of multiple transmembrane domains is consistent with SEL-12 function as a receptor, ligand, channel or membrane structural protein.

The fact that the only striking phenotype caused by sel-12(ar171) is a defect in egg-laying may reflect the fact that egg-laying is particularly sensitive to reduction in lin-12 activity (Sundaram and Greenwald, 1993a; H. Wilkinson and I. G., unpublished observations). The egg-laying defect may reflect an as yet unidentified cell fate decision(s), or alternatively may also be viewed as a late-onset behavioral phenotype. However, the fact that sel-12(ar171) mutants do not display all of the defects associated with loss of lin-12 function may indicate that sel-12(ar171) is not a null allele, despite the severe truncation in protein product it is expected to cause; alternatively, sel-12 function may be partially redundant with the function of another gene.

Applicants identified a genomic fragment capable of complementing sel-12 alleles (Levitan and Greenwald, 1995).

Some of the experiments described in this invention require the ability to express reporter genes or altered sel-12 genes appropriately. An expression method developed in applicants, laboratory will enable these experiments to be performed. (1) Applicants have developed a vector that expresses inserted cDNAs under the control of lin-12 regulatory sequences (pLEX; Struhl et al., 1993). The applicants have found that construct containing a sel-12 cDNA in the pLEX vector is capable of rescuing sel-12 mutants. (2) Applicants have developed an analogous vector, p1B7, that should express inserted cDNAs under the control of sel-12 regulatory sequences. p1B7 is based on a genomic fragment that is capable of rescuing sel-12 mutants (Levitan and Greenwald, 1995): a unique BamHI site was inserted at +1 into a genomic fragment capable of complementing a mutant allele, thereby destroying the first codon of the gene. The expression vector contains 3.5 kb of 5' flanking region (2.5 kb more than the original rescuing fragment of Levitan and Greenwald, 1995) and 0.5 kb of 3' flanking region.

These vectors are used as follows (Wilkinson et al., 1994; Fitzgerald and Greenwald, 1995; Wilkinson and Greenwald, 1995). A cDNA containing