Infectious bovine viral diarrhea virus clone Number:7,135,561 from the United States Patent and Trademark Office (PTO) owispatent The invention belongs to the field of animal health and in particular Bovine Viral Diarrhea Virus (BVDV). The invention provides infectious BVDV clones and methods to produce said BVDV clones. The invention further relates to methods of attenuating said clones, attenuated BVDV clones and vaccines comprising said attenuated clones.<H Infectious, diarrhea, Infectious, bovi, 7135561.html, Patent, pto, 7135561

Title: Infectious bovine viral diarrhea virus clone

Abstract: The invention belongs to the field of animal health and in particular Bovine Viral Diarrhea Virus (BVDV). The invention provides infectious BVDV clones and methods to produce said BVDV clones. The invention further relates to methods of attenuating said clones, attenuated BVDV clones and vaccines comprising said attenuated clones.

Patent Number: 7,135,561 Issued on 11/14/2006 to Elbers, et al.

Inventors: Elbers; Knut (Gau Algesheim, DE), Meyer; Christiane (Muenster, DE), Von Freyburg; Martina (Tuebingen, DE), Meyers; Gregor (Walddorfhaeslach, DE)
Assignee: Boehringer Ingelheim Vetmedica GmbH (St. Joseph, MO)

Appl. No.: 10/236,542

Filed: September 6, 2002

Foreign Application Priority Data


Sep 06, 2001 [DE]			101 43 813

Current U.S. Class: 536/23.72 ; 424/218.1; 424/93.6; 435/320.1

Current International Class: C07H 21/04 (20060101); A01N 63/00 (20060101); A61K 39/12 (20060101); C12N 15/09 (20060101); C12Q 1/70 (20060101)

References Cited [Referenced By]

U.S. Patent Documents


6001613	December 1999	Donis et al.

Foreign Patent Documents


1013757	Jun., 2000	EP
WO-9964604	Dec., 1999	WO
WO 01/39801	Jun., 2001	WO

Other References

Sequence alignment provided of SEQ ID No. 1 with GenEmbl database accession No. BVU18059, submitted Dec. 7, 1995. cited by examiner .
Collett, Marc S. et al; Proteins Encoded by Bovine Viral Diarrhea Virus: The Genomic Organization of a Pestivirus; Virology: (1988) 200-208; vol. 165. cited by other .
Meyer, Christiane; Recovery of Virulent and RNase-Negative Attenuated Type 2 Bovine Viral Diarrhea Viruses from Infectious cDNA Clones; (2002) 8494-8503; vol. 76; No. 16. cited by other .
Meyers, Gregor et al; Mutations Abrogating the RNase Activity in Glycoprotein Erns of the Pestivirus Classical Swine Fever Virus Lead to Virus Attenuation; Journal of Virology (1999) 10224-10235; vol. 73; No. 12. cited by other .
Tratschin, Jon-Duri et al; Classical Swine Fever Virus Leader Proteinase NPRO Is Not Required for Viral Replication in Cell Culture; Journal of Virology (1998) 7681-7684; vol. 72; No. 9. cited by other .
Moser, Christian et al; A Recombinant Classical Swine Fever Virus Stably Expresses a Marker Gene; Journal of Virology (1998) 5318-5322; vol. 72; No. 6. cited by other .
Becher, Paul et al; Phylogenic analysis of pestiviruses from domestic and wild ruminants; Journal of eneral Virology (1997) 1357-1366; vol. 78. cit- ed by other .
Tijssen, P. et al; Immunodominant E2 (gp53) Sequences of Highly Virulent Bovine Viral Diahrrhea Group II Viruses Indicate a Close Resemblence to a Subgroup of Border Disease Viruses; Virology (1996) 356-361; vol. 217. cited by other .
Schaefer, Brian; Revolutions in Rapid Amplification of cDNA Ends: New Strategies for Polymerase Chain reaction Cloning of Full-Length cDNA Ends; analytical Biochemistry; (1995) 255-273; vol. 227. cited by other .
Avalos-Ramirez, Ramiro et al; Evidence for the Presence of Two Novel Pestivirus Species: Virology (2001) 456-465 vol. 286. cited by other .
Stoffregen, B. et al; Morphologic lesions in type 2 BVDV Infections experimentally induced by strain BVDV2-1373 recovered from a field case: Veterinary Microbiology (2000) 157-162: vol. 77. cited by other .
van Gennip, H.G.P. et al; Recovery of infectious clasiical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase: Journal of Virological Methods (1999) 117-128; vol. 78. cited by other .
Odeon, A. C. et al; Experimental infection of calves with bovine viral diarrhea virus genotype II (NY-93): J Vet Diagn Invest 11: 221-228. cited by other .
Racaniello, V.R. et al; Cloned Poliovirus Complimentary DNA Is Infections in Mammalian Cells; Science, 1981;214:916-919. cited by other .
Carman, S. et al: Severe acute bovine viral diarrhea in Ontario, 1993-1995; J. Vet. Diagn Invest., 1998, 10:27-35. cited by other .
The copending applications cited below are brought to the Examiner's attention but are not conceded to be prior art. cited by other .
Elbers, K. et al: Safe Attenuated Bovine Viral Diarrhea Viruses For Use In Pregnant Cows, U.S. Appl. No. 09/706,649, filed Nov. 6, 2000. cited by other .
Meyers, G.: Attenuated pestiviruses, U.S. Appl. No. 09/325,542, filed Apr. 6, 1999. cited by other .
Julia F. Ridpath et al; The Genomic Sequence of a Virulent Bovine Viral Diarrhea Virus (BVDV) from the Type 2 Genotype: Detection of a Large Genomic Insertion in a Noncytopathic BVDV; Virology (1995) vol. 212 pp. 39-46; Virology Cattle Research National Animal Disease Center, Iowa. cit- ed by other .
Christina L. Topliff et al; Virulence Markers in the 5' Untranslated Region of Genotype 2 Bovine Viral Diarrhea Virus Isolates; Virology (1998) vol. 250 p. 164-172; Agricultural Research Division University of Nebraska. cited by other .
Beate M. Kummerer et al; Correlation between Point Mutations in NS2 and the Viability and Cytopathogenicity of Bovine Viral Diarrhea Virus Strain Oregon Analyzed with an Infections cDNA Clone: Journal of Virology Jan. 2000 vol. 74 No. 1 p. 390-400; American Society for Microbiology. cited by other .
Gregor Meyers et al; Recovery of Cytopathogenic and Noncytopathogenic Bovine Viral Diarrhea Viruses from cDNA Constructs; Journal of Virology Dec. 1996 vol. 70 No. 12 p. 8606-8613; American Society of Microbiology. cited by other .
Ventzislav B. Vassilev et al; Authentic and Chimeric Full-Length Genomic cDNA Clones of Bovine Viral Diarrhea Virus that Yield Infectious Transcriptst; Journal of Virology Jan. 1997 vol. 71 No. 1 p. 471-478: American Society for Microbiology. cited by other .
Database Accession No. AF145967; XP002251610. cited by other .
Copy of International Search Report for Reference PCT/EP 02/09925. cited by other .
Constans, Aileen; Recent Developments in RT-PCR Technology Move Reverse Transcription in the right direction; The Scientist-Reverse Psychology 14[17]; 29, Sep. 4, 2000 pp. 1-4. cited by other .
van der Poel, W.H.M.; Experimental Reproduction of Respiratory Disease in Calves with Non-Cell-Culture-Passaged Bovine respiratory Synctial Virus, The Veterinary Quarterly, vol. 18, No. 3, Sep. 1996--XP 009041333, pp. 81-86. cited by other.

Primary Examiner: Campell; Bruce R.
Assistant Examiner: Blumel; Benjamin P.
Attorney, Agent or Firm: Morris; Michael P. Devlin; Mary-Ellen M.

Parent Case Text

RELATED APPLICATION

This application claims priority benefit of U.S. provisional application Ser. No. 60/322,974, filed Sep. 18, 2001.

Claims

What is claimed is:

1. An isolated DNA molecule containing a nucleotide sequence selected from the group consisting of (a) a full-length SEQ ID NO. 1, and (b) a full-length variant of SEQ ID NO. 1, based on the degenerative nature of the genetic code, wherein the isolated DNA molecule can be used to generate an attenuated BVDV type 2 clone effective in preventing fetal infection after challenge with a heterologous challenge virus of the BVDV type 1 antigenic group.

2. An isolated infectious BVDV clone, capable of serving as a template for transcription into an RNA, wherein the RNA, when introduced into susceptible host cells, induces the generation of infectious BVDV particles and wherein the RNA sequence is complementary to a nucleotide sequence selected from the group consisting of (a) a full-length SEQ ID NO. 1, and (b) a full-length variant of SEQ ID NO. 1, based on the degenerative nature of the genetic code, wherein the isolated DNA molecule can be used to generate an attenuated BVDV type 2 clone effective in preventing fetal infection after challenge with a heterologous challenge virus of the BVDV type 1 antigenic group.

3. A BVDV particle generated by transcribing the DNA molecule according to claim 1 or the BVDV clone according to claim 2.

4. The DNA molecule according to claim 1, wherein the nucleotide sequence comprises SEQ ID NO. 1.

5. A method of preventing fetal infection after challenge with a heterologous virus of the BVDV type 1 antigenic group in an animal in need thereof comprising administering to the animal an attenuated BVDV type 2 clone generated from an isolated DNA molecule containing a nucleotide sequence selected from the group consisting of (a) a full-length SEQ ID NO. 1, and (b) a full-length variant of SEQ ID NO. 1, based on the degenerative nucleic acid code.

Description

BACKGROUND OF THE INVENTION

The invention belongs to the field of animal health and in particular Bovine Viral Diarrhea Virus (BVDV). The invention provides infectious BVDV clones and methods to produce said BVDV clones. The invention further relates to methods of attenuating said clones, attenuated BVDV clones and vaccines comprising said attenuated clones.

Bovine Viral Diarrhea Virus (BVDV) is the causative agent of BVD and mucosal disease in cattle (Baker, J. C., 1987, J. Am. Vet. Med. Assoc. 190:1449 1458; Moennig, V. and Plagemann, J., 1992; Adv. Virus Res. 41:53 91; Thiel, H. J. et al., 1996, Fields Virology 1059 1073). Fetal infection during pregnancy can result in the resorption of the fetus, abortions, as well as birth of immunotolerant calves which are persistently infected with BVDV. These calves lack or have very low neutralizing antibody titers and are continuously shedding high amounts of virus. Next to acutely infected cattle these calves are the major source for virus spreading and are therefore of prime importance in the epidemiology of this disease. The major economical impact of BVD results from high abortion rates, stillbirths, fetal resorption, mummification, congenital malformations, and birth of weak and undersized calves. For a detailed review of the pathogenesis, hereby refer to the article of Moennig, V. and Liess, B. of 1995, Virus, 11(3):477 487.

Two major antigenic groups of BVDV (type 1 and 2) have been described (Becher, P. et al. 1999, Virology 262:64 71) which display limited cross neutralizing antibody reactions (Ridpath, J. F., et al. 1994, Virology 205:66 74).

Present vaccines for the prevention and treatment of BVDV infections still have drawbacks (Oirschot, J. T., et al. 1999, Veterinary Microbiology, 64:169 183). Vaccines against the classical BVDV type 1 provide only partial protection from type 2 infection, and vaccinated dams may produce calves that are persistently infected with virulent BVDV type 2 (Bolin, S. R., et al., 1991, Am. J. Vet. Res. 52:1033 1037; Ridpath, J. F., et al., 1994, Virology 205:66 74). This problem is probably due to the great antigenic diversity between type 1 and type 2 strains which is most pronounced in the glycoprotein E2, the major antigen (Tijssen, P., et al., 1996, Virology 217:356 361). most monoclonal antibodies against type 1 strains fail to bind to type 2 viruses (Ridpath, J. F., et al., 1994, Virology 205:66 74).

Killed vaccines (inactivated whole virus) or subunit vaccines (conventionally purified or heterologously expressed purified viral proteins) are most often inferior to live vaccines in their efficacy to produce a full protective immune response even in the presence of adjuvants.

Live BVDV vaccines, although attenuated, are most often associated with safety problems. As mentioned above, they cross the placenta of pregnant cows and lead to clinical manifestations in the fetus and/or the induction of persistently infected calves. Therefore, they cannot be applied to breeding herds that contain pregnant cows. Pregnant cows have to be kept separate from vaccinated cattle to protect fetuses and must not be vaccinated themselves. Furthermore, revertants of attenuated live BVDV pose a serious threat to cattle. For conventionally derived attenuated viruses wherein the attenuation is achieved by conventional multiple passaging, the molecular origin as well as the genetic stability of the attenuation remains unknown and reversion to the virulent wild-type is unpredictable.

Live vaccines with defined mutations as a basis for attenuation would overcome the disadvantages of the present generation of attenuated vaccines. A further advantage of said attenuating mutations lies in their defined molecular uniqueness which can be used as a distinctive label for the attenuated pestivirus to distinguish it from pestiviruses from the field.

In the art, BVDV of defined genetic identity which closely resemble wild-type viruses are hardly known, in particular not for type 2 BVDV. In the art, there was a long lasting need for methods to generate such BVDV. Therefore, the technical problem underlying this invention was to provide a BVDV, in particular a BVDV type 2, of defined genetic identity.

SUMMARY OF THE INVENTION

The invention relates to a DNA molecule comprising a nucleotide sequence complimentary to a BVDV RNA, wherein said RNA induces the generation of infectious BVDV particles in susceptible host cells. In an embodiment, administration of a dose of 6.times.10.sup.6TCID.sub.50 of the infectious BVDV particles to a calf induces viraemia and leukopenia in said calf for a period of at least one day and induces diarrhea or pyraemia for a period of at least one day. In another embodiment, said infectious BVDV particles have authentical virulence as compared to a wild-type BVDV isolate from which said DNA molecule was derived. In another embodiment, administration of a dose of 6.times.10.sup.6TCID.sub.50 per calf of said infectious BVDV particles to BVDV naive calves is lethal for at least 30% of said calves within 21 days.

In another embodiment, said BVDV particles have a virulence of at least 90% of BVDV particles comprising an RNA, wherein the nucleotide sequence of said RNA is complementary to SEQ ID NO:1. In another embodiment, the DNA molecules of the invention comprise a nucleotide sequence complementary to a BVDV RNA, whereon the nucleotide sequence of said BVDV RNA comprises a sequence complementary to SEQ ID NO:1. In another embodiment, the DNA molecule of the invention comprises SEQ ID NO:1.

The invention also relates to an infectious BVDV clone, i.e., a vector comprising a DNA molecule of the invention or a host cell strain comprising said vector. In a preferred embodiment, the invectious BVDV clone is a BVDV type 2 clone.

The invention also relates to a BVDV particle generated by transcription of a DNA molecule or a BVDV clone of the invention into RNA, wherein a cell is transfected with said RNA such that BVDV particles are produced by said cell.

The invention also relates to fragments, derivatives and variants of the molecules of the invention.

The invention also relates to a method for producing a BVDV type 2 clone comprising: (a) isolating a wild-type BVDV type 2 strain; (b) passaging said wild-type BVDV type 2 strain in cell culture; (c) infecting a bovine with said passaged wild-type BVDV type 2 strain of step (b); (d) isolating a BVDV type 2 strain from said infected bovine of step (c); (e) passaging said isolated BVDV type 2 strain of step (d) in cell culture no more than two times; (f) transcribing the passaged BVDV type 2 strain of step (c) by reverse transcription; and (g) cloning the transcribed BVDV type 2 strain of step (f). The invention also relates to a BVDV type 2 clone or BVDV strain obtained by methods of the invention. In another embodiment, a BVDV type 2 particle is obtained by: (1) transcribing an infectious DNA clone of the invention into RNA; (b) introducing said RNA into a cell such that a BVDV type 2 particle is produced; and (c) collecting said BVDV type 2 particle.

The invention also relates to a method for producing an infectious BVDV clone from a wild-type BVDV isolate comprising: (a) isolating viral particles from an infected bovine; (b) passaging said viral particles not more than two times in cell culture; (c) preparing RNA from said passaged viral particles of step (b); (d) transcribing said RNA by reverse transcription to generate full-length cDNA, wherein said reverse transcription is performed at an elevated temperature and using a thermostable enzyme such that secondary structures of said RNA are broken or reduced; and (e) incorporation of said cDNA into a vector or DNA virus capable of transcribing said cDNA into RNA upon infection of a cell; wherein said infectious BVDV clone is complementary to an RNA having authentical virulence compared to said wild-type BVDV isolate. In an embodiment, said infectious BVDV clone is complementary to an RNA having a virulence of at least 90% of said wild-type isolate.

The invention also relates to a method for producing an infectious BVDV clone from a wild-type BVDV isolate comprising: (a) isolating RNA from cells from an infected bovine; (b) transcribing said RNA by reverse transcription to generate full-length cDNA, wherein said reverse transcription is performed at an elevated temperature and using a thermostable enzyme, such that secondary structures of said RNA are broken or reduced; and (c) incorporating said BVDV cDNA into a vector or DNA virus capable of transcribing said cDNA into RNA upon infection of a cell; wherein said BVDV clone is complementary to an RNA having authentical virulence compared to said wild-type BVDV isolate. In an embodiment, RNA is isolated from a cell of an infected bovine during viraemia. In another embodiment, RNA is isolated from an infected bovine after killing said bovine.

In an embodiment, full-length BVDV cDNA is assembled from cDNA fragments after reverse transcription of RNA, preferably, overlapping cDNA fragements.

The invention also relates to a method of attenuation of a BVDV strain, comprising: (a) introducing one or more mutations into a DNA molecule of the invention, or into a infectious BVDV clone of the invention; (b) introducing the mutated DNA into susceptible host cells wherein said DNA is transcribed into RNA or introducing an RNA transcribed from said DNA into said cells; and (c) collecting viral particles produced by these cells; wherein said mutation or mutations results in attenuation. Preferably, the mutation or mutations is a nucleotide substitution, deletion, insertion, addition, or combination thereof.

The invention encompasses BVDV clones wherein the RNase activity residing in glycoprotein En is inactivated. Preferably, said RNase activity is inactivated by deletion and/or other mutation such as substitution. Preferably, said deletions and/or other mutations are located at the amino acids at position 295 to 307 and/or position 338 to 357.

Preferably, a method of attenuation of the invention comprises: (a) deletion of all or part of the glycoprotein E.sup.ms; and/or (b) deletion or substitution of histidine at position 300 of SEQ ID NO:1; and/or (c) deletion or substitution of histidine at position 349 of SEQ ID NO:1.

Most preferably, a method for the attenuation of BVDV, comprises mutation of a BVDV clone according to the invention at histidine position 300 and/or position 349 wherein the coding triplet in the nucleotide sequence is deleted or substituted.

In another embodiment, a method for the attenuation of BVDV according to the invention, comprises substituting the codon encoding histidine 300 for a codon encoding leucine.

Yet another important embodiment is a method for the attenuation of BVDV according to the invention, wherein the codon encoding histidine 349 is deleted.

Another important embodiment of the invention is a vaccine comprising an attenuated BVDV clone or strain according to the invention, optionally in combination with a pharmaceutically acceptable carrier or excipient.

The invention further relates to the use of an attenuated BVDV clone or strain according to the invention in the manufacture of a vaccine for the prophylaxis and/or treatment of BVDV infections.

Preferably, a vaccine of the invention refers to a vaccine as defined above, wherein one immunologically active component is a live BVDV, wherein the RNase activity in its protein E.sup.ms is inactivated.

Preferably, a vaccine according to the invention comprises an attenuated BVD virus type 1 according to the invention combined with an attenuated BVD virus type 2 according to the invention or any other antigenetic group and a pharmaceutically acceptable carrier or excipient. Said vaccine may be administered as a combined vaccine. Most preferably, said attenuated BVD virus type 1 according to the invention may be administered first, followed by an administration of an attenuated BVD virus type 2 according to the invention three to four weeks later.

Preferably, a vaccine according to the invention comprises an attenuated BVD virus type 1 according to the invention wherein the RNase activity in its protein E.sup.ms is inactivated, combined with an attenuated BVD virus type 2 according to the invention wherein the RNase activity in its protein E.sup.ms is inactivated, or any other antigenetic group wherein the RNase activity in its protein E.sup.ms is inactivated, and a pharmaceutically acceptable carrier or excipient. Said vaccine may be administered as a combined vaccine. Most preferably, said attenuated BVD virus type 1 according to the invention as described supra may be administered first, followed by an administration of an attenuated BVD virus type 2 according to the invention as described supra three to four weeks later.

The invention preferably relates to a method of treating a BVDV-infected bovine animal with an attenuated BVDV according to the invention as described supra, wherein said attenuated BVDV or the vaccine composition as disclosed supra is administered to the bovine animal in need thereof at a suitable dose as known to the skilled person and the reduction of BVDV symptoms such as viremia and leukopenia and/or pyrexia and/or diarrhea is monitored. Said treatment preferably may be repeated.

DESCRIPTION OF THE FIGURES

FIG. 1: Construction of the infectious cDNA clone. The upper part sketches a BVDV genome (kB) and the encoded polyprotein. The middle part shows the cDNA clones (white), the RT-PCR product (light grey) and the PCR products (dark grey) used for engineering the infectious cDNA clone. The lower part depicts the ends of the genomic cDNA sequences (underlined) and the sequences added at the 5' and 3' ends for in vitro transcription.

FIG. 2: Growth curves of the recombinant virus XIKE-A and the wild type BVDV isolate VLS#399. MDBK cells were infected with the viruses at an m.o.i of 0.1 and harvested by freezing and thawing at the indicated time points. Titers were determined after infection of new MDBK cells by immunofluorescence staining 72 h p.i.

FIG. 3: Growth curves of the recombinant virus XIKE-A and the E.sup.ms mutants XIKE-B (H349.DELTA.) and XIKE-C (H300L). MDBK cells were infected with the viruses at an m.o.i of 0.1 and harvested by freezing and thawing at the indicated time points. Titers were determined after infection of new MDBK cells by immunofluorescence staining 72 h p.i.

FIG. 4: Determination of RNase activity of the recombinant viruses XIKE-A (wild-type sequence), XIKE-B (H349A) and XIKE-C (H300L) in comparison with the wild type strain New York '93/C from crude cell extracts of MDBK cells infected with the respective viruses. MDBK cells that were not infected served as a negative control (n.i.). The enzymatic degradation of poly(U) was determined by measuring the OD.sub.260 as a marker of the release of small RNA fragments into the supernatant.

FIG. 5: Body temperatures of animals infected with New York '93/C (animal #275, #612 and #1610, broken lines) or XIKE-A (animal #615, #377 and #091, solid lines).

FIG. 6: White blood cell 1 (WBC) counts of animals infected with New York '93/C (animals #275, #612 and #1610, broken lines) or XIKE-A (animals #615, #377 and #091, solid lines).

FIG. 7: Body temperatures of animals infected with XIKE-A (animal #387, #388 and #418, broken lines) or XIKE-B (animal #415, #417 and #419, solid lines).

FIG. 8: White blood cell 1 (WBC) counts of animals infected with XIKE-A (animals #387, #388 and #418, broken lines) or XIKE-B (animals #415, #417 and #419, solid lines).

DESCRIPTION OF THE INVENTION

Definitions of Terms Used in the Description:

Before the embodiments of the present invention it must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a BVDV virus" includes a plurality of such BVDV viruses, reference to "the cell" is a reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated by reference. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

The term "BVDV" as used herein refers to all viruses belonging to species BVDV 1 and BVDV 2 in the genus pestivirus within the family Flaviviridae (Becher, P., et al. 1999, Virology 262:64 71).

The more classical BVDV type 1 strains and the more recently recognized BVDV type 2 strains display some limited but distinctive differences in nucleotide and amino acid sequences.

A "clone" is a DNA vector or host cell strain into which such vector has been introduced. Preferably, the DNA vector is a plasmid.

An "infectious clone" is a DNA vector with the capability to serve as a template for transcription into an RNA that induces the generation of the virus when introduced into susceptible cells. Preferably the RNA is produced by in vitro transcription and introduced into the cells by transfection technologies known to the skilled person.

"BVDV particles" or "viral particles" as used herein relate to BVD viruses generated from "infectious clones" via RNA, that will induce production of said BVDV particles when introduced into susceptible cells.

The term "attenuated BVDV particles" or "attenuated viral particles" as used herein relates to BVDV particles attenuated by a method according to the invention (see infra).

"Infectivity" is the capability of a virus or viral particle to induce a certain number of plaques in a plaque test or a certain TCID.sub.50 score in an endpoint test.

A full-length RNA is an RNA comprising at least 98% of the sequence of an RNA occurring in a wild-type isolate. A full-length complementary DNA is a DNA comprising a sequence complementary to at least 98% of an RNA occuring in a wild-type isolate.

As used herein, "calf" relates to a bovine animal of six months of age or less. Virulence: "Authentical virulence" as used herein means that there is no statistically significant difference between the virulence of infectious BVDV particles according to the invention and wild-type BVDV isolates from which said DNA molecules containing a nucleotide sequence complementary to a BVDV RNA, preferably a type 2 RNA has been derived, for at least one predominant clinical parameter. Examples of such predominant clinical parameters are diarrhea, pyrexia and/or lethality.

Attenuation: "An attenuated BVDV particle" as used herein means that there is a statistically significant difference between the virulence of attenuated BVDV particles according to the invention, said attenuated BVDV particles being attenuated by a method according to the invention, and wild-type BVDV isolates from which said attenuated BVDV particles have been derived, for the predominant clinical parameters diarrhea, pyrexia and lethality in animals infected with the same dose, preferably 6.times.10.sup.6TCID.sub.50. Thus, said attenuated BVDV particles do not cause diarrhea, pyrexia and lethality and thus may be used in a vaccine.

"RACE" as used herein means rapid amplification of cDNA ends and is known as such in the art (Frohman et al, Proc. Natl. Acad. Sci USA 1988, 85: 8998 9002).

"Susceptible cell" as used herein is a cell which can be infected with BVDV or transfected with BVDV RNA, wherein said virus or RNA, when introduced into said susceptible cells, induces the generation of infectious BVDV.

A "fragment" according to the invention is any subunit of a DNA molecule or infectious BVDV clone according to the invention, i.e. any subset, characterized in that it is encoded by a shorter nucleic acid molecule than disclosed which can still be transcribed into RNA.

A "functional variant" of the DNA molecule or infectious BVDV clone according to the invention is a DNA molecule or infectious BVDV clone which possesses a biological activity (either functional or structural) that is substantially similar to the DNA molecule or infectious BVDV clone according to the invention. The term "functional variant" also includes "a fragment", "a functional variant", "variant based on the degenerative nucleic acid code" or "chemical derivative". Such a "functional variant" e.g. may carry one or several nucleic acid exchanges, deletions or insertions. Said exchanges, deletions or insertions may account for 10% of the entire sequence. Said functional variant at least partially retains its biological activity, e.g. function as an infectious clone or a vaccine strain, or even exhibits improved biological activity.

A "variant based on the degenerative nature of the genetic code" is a variant resulting from the fact that a certain amino acid may be encoded by several different nucleotide triplets. Said variant at least partially retains its biological activity, or even exhibits improved biological activity.

A "fusion molecule" may be the DNA molecule or infectious BVDV clone according to the invention fused to e.g. a reporter such as a radiolabel, a chemical molecule such as a fluorescent label or any other molecule known in the art.

As used herein, a "chemical derivative" according to the invention is a DNA molecule or infectious BVDV clone according to the invention chemically modified or containing additional chemical moieties not normally being part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half life etc.

A molecule is "substantially similar" to another molecule if both molecules have substantially similar nucleotide sequences or biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein if the nucleotide sequence is not identical, and two molecules which have a similar nucleotide sequence are considered variants as that term is used herein even if their biological activity is not identical.

The term "vaccine" as used herein refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immunological response in an animal and possibly but not necessarily one or more additional components that enhance the immunological activity of said active component. A vaccine may additionally comprise further components typical of pharmaceutical compostions. The immunologically active component of a vaccine may comprise complete virus particles in either their original form or as attenuated particles in a so called modified live vaccine (MLV) or particles inactivated by appropriate methods in a so called killed vaccine (KV). In another form, the immunologically active component of a vaccine may comprise appropriate elements of said organisms (subunit vaccines) whereby these elements are generated either by destroying the whole particle or the growth cultures containing such particles and optionally subsequent purification steps yielding the desired structure(s), or by synthetic processes including an appropriate manipulation by use of a suitable system based on, for example, bacteria, insects, mammalian or other species plus optionally subsequent isolation and purification procedures, or by induction of said synthetic processes in the animal needing a vaccine by direct incorporation of genetic material using suitable pharmaceutical compositions (polynucleotide vaccination). A vaccine may comprise one or simultaneously more than one of the elements described above.

The term "vaccine" as understood herein is a vaccine for veterinary use comprising antigenic substances and is administered for the purpose of inducing a specific and active immunity against a disease provoked by BVDV. The BVDV clone according to the invention confers active immunity that may be transferred passively via maternal antibodies against the immunogens it contains and sometimes also against antigenically related organisms.

Additional components to enhance the immune response are constituents commonly referred to as adjuvants, e.g. aluminium hydroxide, mineral or other oils or ancillary molecules added to the vaccine or generated by the body after the respective induction by such additional components, including but not restricted to interferons, interleukins or growth factors.

A "pharmaceutical composition" essentially consists of one or more ingredients capable of modifying physiological e.g. immunological functions of the organism it is administered to, or of organisms living in or on the organism. The term includes, but is not restricted to antibiotics or antiparasitics, as well as other constituents commonly used to achieve certain other objectives like, but not limited to, processing traits, sterility, stability, feasibility to administer the composition via enteral or parenteral routes such as oral, intranasal, intravenous, intramuscular, subcutaneous, intradermal or other suitable route, tolerance after administration, controlled release properties.

DISCLOSURE OF THE INVENTION

The solution to the above technical problem is achieved by the description and the embodiments characterized in the claims.

The long lasting need in the art has been overcome for a live BVDV (bovine viral diarrhea virus) of defined sequence and specificity correlated to virulence which can be used to generate specific attenuated BVDV for use, for example, in a vaccine. The inventors for the first time provide a method to generate infectious clones and infectious BVDV particles derived thereof of defined genetic identity which at the same time have the pathogenicity closely resembling the wild-type virus.

Furthermore, the inventors for the first time disclose an infectious type 2 clone and infectious type 2 BVDV particles derived thereof. Thirdly, the inventors also disclose a method to generate attenuated BVDV particles with genetic identity which may be attenuated by modification at only one defined genetic marker site. The methods of the invention can be used to disclose a causal link between genome modification and attenuation, which is essential in order to understand the functional mechanism of the attenuation and therefore is helpful in assessing the quality for use as a vaccine.

In a first important embodiment, the invention relates to a DNA molecule containing a nucleotide sequence complementary to a BVDV RNA, wherein said RNA, when introduced into susceptible host cells, induces the generation of infectious BVDV particles: a) with the capability to induce viraemia and leukopenia in a calf for a period of at least one day and at least one of the following clinical symptoms of the group comprising diarrhea and/or pyrexia lasting at least one day when infected with a dose of 6.times.10.sup.6TCID.sub.50; and/or b) with authentical virulence as defined supra as compared to a wild-type BVDV isolate from which such DNA molecule has been derived; and/or c) which are, when BVDV naive calves are infected at a dose of 6.times.10.sup.6TCID.sub.50 with such particles, lethal for at least 30% of such calves within a period of 21 days; and/or d) with a virulence of not less than 90% of BVDV particles comprising an RNA with a sequence complementary to SEQ ID NO:1; and/or e) comprising a sequence complementary to SEQ ID NO:1.

Said dose of 6.times.10.sup.6TCID.sub.50 of step a) is preferably administered as 2.times.10.sup.6 i.m. (gluteal muscle), 2.times.10.sup.6 intranaseally, and 2.times.10.sup.6 subcutaneously (over scapula) to obtain a total dose of 6.times.10.sup.6. Said clinical symptoms of step a) preferably should be observed in at least two thirds of all infected animals. Said leukopenia of step a) preferably shall be at least a 35% reduction below baseline on at least two consecutive days, wherein "baseline" relates to the average values of all animals 10 days before infection. Diarrhea is a typical symptom of infection with BVDV.

Preferably, in a DNA molecule according to the invention as described supra the pyrexia of step a) is at least 40.degree. C.

In a second important embodiment the invention relates to an infectious BVDV clone, capable of serving as a template for transcription into an RNA, wherein said RNA, when introduced into susceptible host cells, induces the generation of infectious BVDV particles: f) with the capability to induce viraemia and leukopenia in calves for a period of at least one day and at least one of the following clinical symptoms of the group comprising diarrhea and/or pyrexia lasting at least one day when infected with a dose of 6.times.10.sup.6TCID.sub.50; and/or g) with authentical virulence as compared to a wild-type BVDV isolate from which such DNA molecule has been derived; and/or h) which are, when BVDV naive calves aged from 3 to 6 months are infected at a dose of 6.times.10.sup.6TCID.sub.50 with such particles, lethal for at least 30% of such calves within a period of 21 days after infection; and/or i) with a virulence of not less than 90% of BVDV particles comprising an RNA with a sequence complementary to SEQ ID NO:1; and/or j) comprising a sequence complementary to SEQ ID NO:1.

Said dose of 6.times.10.sup.6TCID.sub.50 of step f) is preferably administered as 2.times.10.sup.6 i.m. (gluteal muscle), 2.times.10.sup.6 intranaseally, and 2.times.10.sup.6 subcutaneously (over scapula) to obtain a total dose of 6.times.10.sup.6. Said clinical symptoms of step a) preferably should be observed in at least two thirds of all infected animals. Said leukopenia of step f) preferably shall be at least a 35% reduction below baseline on at least two consecutive days, wherein "baseline" relates to the average values of all animals 10 days before infection.

Said infectious BVDV clone preferably is a type 1 or type 2 clone.

As it is important that said infectious BVDV clone is of authentical virulence, the virus that serves as the origin for constructing such clone is preferably obtained directly from a field isolate or retransferred to animals and subsequently reisolated from the animal with the strongest clinical symptoms and subsequently passaged no more than twice in cell culture, preferably once or not at all. For an illustration example, see Example 1. Example 1 demonstrates the cDNA-cloning of virus NY93/C which is, after several cell culture passages, retransferred into a bovine animal, reisolated and used for RNA preparation and cDNA cloning after not more than two cell culture passages of the reisolated virus.

Another important embodiment of the invention is a BVDV particle generated by transcription using the DNA molecule or the BVDV clone according to the invention into RNA, the transfection of suitable cells or cell lines with said RNA and the collection of the resulting BVDV particles produced by said cells. Yet another embodiment is a BVDV particle generated by cloning the DNA molecule or the BVDV clone according to the invention into the genome of a suitable DNA virus, such DNA viruses being known to the artisan, followed by infection of suitable cells resulting in generation of BVDV particles produced by said cells. Preferably also, the DNA or infectious clone according to the invention may be transfected into suitable cells which then produce the RNA as disclosed for classical swine fever virus (CSFV) by van Gennip, G., et. al. (1999, J. Virol. Methods 78:117 128) for cells which stably express T7 Polymerase. Also preferably the DNA or infectious clone according to the invention may be expressed under control of a eukaryotic promotor in eukaryotic cells leading to the generation of infectious BVDV particles being able to be secreted from the cell (as exemplified by Racaniello, V. R. and Baltimore, D. for poliovirus, 1981, Science 214:916 919).

A highly important embodiment of the invention is an infectious BVDV type 2 clone. Preferably, said infectious BVDV type 2 clone, capable of serving as a template for transcription into an RNA, wherein said RNA, when introduced into susceptible host cells, induces the generation of infectious BVDV particles: k) with the capability to induce viraemia and leukopenia in calves for a period of at least 1 day and at least one of the following clinical symptoms of the group comprising diarrhea and/or pyrexia lasting at least one day when infected with a dose of 6.times.10.sup.6TCID.sub.50; and/or l) with authentical virulence as compared to a wild-type BVDV isolate from which such DNA molecule has been derived; and/or m) which are, when BVDV naive calves aged from 3 to 6 months are infected at a dose of 6.times.10.sup.6TCID.sub.50 with such particles, lethal for at least 30% of such calves within a period of 21 days after infection; and/or n) with a virulence of not less than 90% of BVDV particles comprising an RNA with a sequence complementary to SEQ ID NO:1; and/or o) comprising a sequence complementary to SEQ ID NO:1.

Preferably, the invention relates to a BVDV type 2 clone obtainable by a method characterized by the following steps: aaa) a wild-type BVDV type 2 strain is isolated; bbb) said wild-type BVDV type 2 strain is passaged in cell-culture; ccc) said cell culture-passaged BVDV type 2 strain is used to infect bovine animals and a BVDV strain is re-isolated from the most severely infected animal; ddd) said re-isolated BVDV type 2 strain is passaged no more than twice, preferably once, in cell culture; eee) said re-isolated BVDV type 2 strain is reverse-transcribed and cloned resulting in a full-length cDNA clone, preferably the 5' and 3' ends are cloned using the RACE-technology.

Said infectious DNA clone may then be transcribed into RNA under appropriate conditions, said RNA is introduced into appropriate cells or cell lines and the resulting BVDV type 2 particle is collected. Such a clone is exemplified in the non-limiting Example 1 and characterized by the cDNA sequence SEQ ID NO:1. Thus, a preferred embodiment relates to an infectious BVDV type 2 clone according to the invention as characterized by the DNA sequence of SEQ ID NO:1 or a fragment, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof. A non-limiting example is provided in Example 1.

The invention further relates to a BVDV type 2 particle generated by in vitro transcription of the BVDV clone according to the invention into RNA, the transfection of suitable cells or cell lines with said RNA and the collection of the resulting BVDV particles produced by said cells. Preferably also, the DNA or infectious clone according to the invention may be transfected into suitable cells which then produce the RNA as disclosed for classical swine fever virus (CSFV) by van Gennip, H. G., et. al., 1999, J. Virol. Methods 78:117 128, for cells which stably express T7 Polymerase. Also preferably the DNA or infectious clone according to the invention may be expressed under control of a eukaryotic promotor in eukaryotic cells leading to the generation of infectious BVDV particles being able to be secreted from the cell (as exemplified by Racaniello, V. R. and Baltimore, D. for poliovirus 1981,Science 214:916 919).

Another highly important aspect of the invention is a DNA molecule containing a nucleotide sequence complementary to a full-length BVDV type 2 RNA. Preferably, said DNA molecule is characterized by the sequence SEQ ID NO:1. Thus, the invention further relates to a DNA molecule according to the invention as characterized by SEQ ID NO:1 or a fragment, functional variant, variant based on the degenerative nucleic acid code, fusion molecule or a chemical derivative thereof. A non-limiting example is provided in Example 1.

Most preferably, the invention relates to a DNA molecule according to the invention, consisting of the sequence comprising SEQ ID NO:1.

The invention further relates to an RNA molecule complementary to the DNA molecule according to the invention as described supra, or to the BVDV clone according to the invention as described supra.

The invention also relates to an RNA molecule obtainable by transcription of the DNA molecule according to the invention as described supra, or the BVDV clone according to the invention as described supra.

Another important aspect of the invention is a method for the production of an infectious BVDV clone from a wild-type BVDV isolate, said infectious BVDV clone being complementary to an RNA having authentical virulence as compared to said wild-type isolate, comprising the steps of: p) isolating viral particles from an infected animal; preferably passaging not more than twice on suitable cell culture cells; q) preparing RNA from the viral particles; r) generating full-length complementary DNA after reverse transcription of the RNA; wherein the reverse transcription includes a step at elevated temperatures sufficient to break or reduce secondary structures of the RNA, and the use of a thermostable enzyme for this step, said enzyme being active at these elevated temperatures; s) incorporating the complementary DNA (cDNA) into a plasmid vector or into a DNA virus capable of directing the transcription of BVDV cDNA into RNA upon infection of suitable cells.

Said viral particles preferably are isolated during viremia (step k)). The full length complementary DNA (cDNA) of step m) preferably may be generated by assembling overlapping partial cDNA fragments (see also Example 1).

Another preferred embodiment relates to a method for the production of an infectious BVDV clone from a wild-type BVDV isolate, said infectious BVDV clone being complementary to an RNA having authentical virulence as compared to said wild-type isolate, comprising the steps of: ppp) isolating RNA from cells of an infected animal during viraemia or optionally after killing of said animal from its organ(s); qqq) generating full-length complementary BVDV DNA which preferably is assembled from DNA fragments after reverse transcription of the RNA; wherein the reverse transcription includes a step at elevated temperatures sufficient to break or reduce secondary structures of the RNA, and the use of a thermostable enzyme for this step, said enzyme being active at these elevated temperatures; and rrr) incorporating the complementary DNA (cDNA) into a plasmid vector or into a DNA virus capable of directing the transcription of BVDV cDNA into RNA upon infection of suitable cells.

Suitable cells for cell culture are Madin-Darby bovine kidney (MDBK) cells, RD (bovine testicular) cells or bovine Turbinat (BT) cells. Further suitable cells are known to the person skilled in the art.

The infectious clone produced by the method according to the invention is a type 1 clone or preferably a type 2 clone.

Another important aspect of the invention is a method for the production of an infectious BVDV clone from a wild-type BVDV isolate, said infectious BVDV clone being complementary to an RNA having a virulence of not less than 90% of said wild-type isolate, comprising the steps of: t) isolating viral particles from an infected animal; u) passaging not more than twice in suitable cell culture cells; preferably once or not at all; v) preparing RNA from the viral particles; w) generating full-length complementary DNA after reverse transcription of the RNA; wherein the reverse transcription includes a step at elevated temperatures sufficient to break or reduce secondary structures of the RNA, and the use of a thermostable enzyme for this step, said enzyme being active at these elevated temperatures; and x) incorporating the complementary DNA (cDNA) into a plasmid vector or into a DNA virus capable of directing the transcription of BVDV cDNA into RNA upon infection of suitable cells.

Said viral particles preferably are isolated during viremia (step t)). The full length complementary DNA (cDNA) of step x) preferably may be generated by assembling overlapping partial cDNA fragments (see also Example 1).

There was a particular difficulty in the art to clone the 5' and 3' region of an infectious BVDV. The inventors developed an inventive method to obtain authentical 5' and 3' regions. Surprisingly, this was possible by applying the RACE-technology. However, only the modification by the inventors of this technique led to the surprising and unexpected generation of BVDV clones of authentic virulence. Preferably, the invention relates to a method according to the invention, wherein the 5' end of the RNA is generated using RACE. Surprisingly, only by applying the RACE technology in conjunction with a thermostable polymerase it was possible to dissolve the secondary structure of the genome successfully.

Standard molecular biology methods are known to the skilled person and can also be found e.g. in Sambrook, S. E., et al.(1989) Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Bertram, S. and Gassen, H. G. Gentechnische Methoden, G. Fischer Verlag, Stuttgart, New York, 1991).

Preferably, the invention relates to a method according to the invention, wherein RACE is carried out with a thermostable polymerase allowing reaction temperatures of at least 48.degree. C., preferably 50 55.degree. C., preferably also 56 60.degree. C.

Having invented live infectious BVDV particles of defined sequence, the inventors also invented a method to generate attenuated BVDV particles with a defined genetic identity which preferably are attenuated at only one defined genetic marker site. This surprisingly allows the simple determination of revertants or the successful attenuation as only the presence of the genetic marker site needs to be determined by molecular biology methods known to the artisan. XIKE-B and XIKE-C of Example 1 are non-limiting examples for such attenuated BVDV particles of defined sequence.

Another important aspect of the invention is a method of BVD virus attenuation by introducing one or more mutations into the DNA molecule according to the invention as described supra or the infectious BVDV clone as described supra, wherein said mutation or mutations lead to or increase an attenuated phenotype of the recovered BVD virus.

Yet another important aspect of the invention is a method of attenuation of a BVDV strain, comprising the steps of: y) introducing one or more mutations into the DNA molecule according to the invention as described supra, or into the infectious BVDV clone according to the invention as described supra; z) introducing the mutated DNA into susceptible host cells wherein said DNA is transcribed into RNA or introducing an RNA transcribed from said DNA into said cells; and aa) collecting viral particles produced by these cells; wherein said mutation or mutations results in attenuation.

A preferred aspect of the invention is a method of attenuation according to the invention as described supra, wherein the mutation or mutations is a nucleotide substitution, deletion, insertion, addition, or combination thereof.

According to the invention, "mutation" means the replacement of a nucleotide or amino acid by another (e.g. C for a T or histidine for leucine), i.e. a so-called "substitution", or any other mutation such as "deletion" or "insertion". "Deletion" means the removal of one or several nucleotides or amino acids. Insertion means the addition of one or more nucleotides or amino acids.

As these infectious BVDV clones according to the invention are viruses of authentical virulence closely resembling wild-type viruses and at the same time having a defined genotype, said virus must be used as a positive control in animal experiments. Said infectious clones are excellent tools for generating specifically attenuated BVDV clones to be used for e.g. vaccination. The invention comprises BVDV clones wherein the RNase activity residing in glycoprotein E.sup.ms is inactivated. Preferably, said RNase activity is inactivated by deletion and/or other mutation such as substitution. Preferably, said deletions and/or other mutations are located at the amino acids at position 295 to 307 and/or position 338 to 357.

Thus, a more preferred aspect of the invention is a method of attenuation according to the invention, wherein the mutation or mutations is in the glycoprotein E.sup.ms and causes impairment or loss of function of the mutated protein.

A more preferred aspect of the invention is a method of attenuation according to the invention, wherein the mutation consists of: bb) deletion of all or part of the glycoprotein E.sup.ms; and/or cc) deletion or substitution of histidine at position 300 of SEQ ID NO:1; and/or dd) deletion or substitution of histidine at position 349 of SEQ ID NO:1.

Most preferably, yet another important embodiment is a method for the attenuation of BVDV, comprising the mutation of a BVDV clone according to the invention at histidine position 300 and/or position 349 wherein the coding triplet in the nucleotide sequence is deleted or substituted.

Yet another important embodiment is a method for the attenuation of BVDV according to the invention, wherein the codon for histidine 300 is substituted by a codon for leucine.

Yet another important embodiment is a method for the attenuation of BVDV according to the invention, wherein the codon for histidine 349 is deleted.

Another important embodiment of the invention is an attenuated BVDV clone or BVDV strain obtainable by a method according to the invention.

Another important embodiment of the invention is a vaccine comprising an attenuated BVDV clone or strain according to the invention, optionally in combination with a pharmaceutically acceptable carrier or excipient.

The invention further relates to the use of an attenuated BVDV clone or strain according to the invention in the manufacture of a vaccine for the prophylaxis and treatment of BVDV infections.

Preferably, a vaccine of the invention refers to a vaccine as defined above, wherein one immunologically active component is a live BVDV, wherein the RNase activity in its protein E.sup.ms is inactivated. The term "live vaccine" refers to a vaccine comprising a particle capable of replication, in particular, a replication active viral component.

Preferably, a vaccine according to the invention comprises an attenuated BVD virus type 1 according to the invention combined with an attenuated BVD virus type 2 according to the invention or any other antigenetic group and a pharmaceutically acceptable carrier or excipient. Said vaccine may be administered as a combined vaccine. Most preferably, said attenuated BVD virus type 1 according to the invention may be administered first, followed by an administration of an attenuated BVD virus type 2 according to the invention three to four weeks later.

Preferably, a vaccine according to the invention comprises an attenuated BVD virus type 1 according to the invention wherein the RNase activity in its protein E.sup.ms is inactivated, combined with an attenuated BVD virus type 2 according to the invention wherein the RNase activity in its protein E.sup.ms is inactivated, or any other antigenetic group wherein the RNase activity in its protein E.sup.ms is inactivated, and a pharmaceutically acceptable carrier or excipient. Said vaccine may be administered as a combined vaccine. Most preferably, said attenuated BVD virus type 1 according to the invention as described supra may be administered first, followed by an administration of an attenuated BVD virus type 2 according to the invention as described supra three to four weeks later.

The invention preferably relates to a method of treating a BVDV-infected bovine animal with an attenuated BVDV according to the invention as described supra, wherein said attenuated BVDV or the vaccine composition as disclosed supra is administered to the bovine animal in need thereof at a suitable dose as known to the skilled person and the reduction of BVDV symptoms such as viremia and leukopenia and/or pyrexia and/or diarrhea is monitored. Said treatment preferably may be repeated.

The following examples serve to further illustrate the present invention, but the same should not be construed as limiting the scope of the invention disclosed herein.

EXAMPLE 1

Materials and Methods

Cells and viruses. MDBK cells were obtained from the American Type Culture Collection (Rockville, Md.). Cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (FCS; tested for the absence of pestivirus and antibodies against pestiviruses) and nonessential amino acids. Bovine viral diarrhea strain New York '93 (field isolate VLS#399) was kindly provided by E. J. Dubovi (New York State College of Veterinary Medicine, Cornell University, Ithaca). The virus underwent one animal passage and was designated "New York '93/C" thereafter.

Infection of cells, immunofluorescence assay and virus peroxidase assay. Since pestiviruses are highly associated with their host cells, lysates of infected cells were used for reinfection of culture cells. Lysates were prepared by freezing and thawing cells 3 to 5 days after infection and were stored at -70.degree. C. Unless indicated otherwise in the text, a multiplicity of infection (m.o.i.) of 0,1 was used for infection of culture cells.

For immunofluorescence and peroxidase assays, the infected cells were fixed with ice-cold acetone:methanol (1:1) for 15 min at -20.degree. C., air dried and rehydrated with phosphate buffered saline (PBS). Cells were then incubated with a mixture of anti-BVDV monospecific antibodies directed against E2 (Weiland, E., et al., 1989, J. Virol. Metholds 24:237 244). After three washes with PBS, a fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse antibody (Dianova, Hamburg, Germany) was used for detecting bound antibodies in the immunofluorescence assays. For peroxidase assays, peroxidase-conjugated goat anti-mouse antibody (Dianova) was used as second antibody. After incubation for one hour at room temperature, cells were washed three times with PBS. Bound antibodies were detected with a solution composed of 50 mM sodium acetate buffer pH 5.0, 1 .mu.M aminoethylcarbazole and 0.1% H.sub.2O.sub.2.

Northern (RNA) hybridization. RNA was prepared 48 hours after infection by cesium density gradient centrifugation as described before (Ruimenapf, T., et al. 1989, Virology 171:18 27). Gel electrophoresis, radioactive labelling of the probe, hybridization, and post-hybridization washes were done as described before (Rutmenapf, T., et al. 1989, Virology 171:18 27). A radioactively labelled PCR product (nucleotides 4301 to 5302) from strain New York 93/C was used as a probe.

PCR and RT-PCR. PCR was carried out either with Tfl-Polymerase (Promega, Mannheim, Germany) or with Taq-Polymerase (Appligene, Heidelberg, Germany) following the manufacturer's recommendations and using approximately 50 100 ng of DNA template and 25 pmol of each primer. The sequences of the primers used for amplification of the 5' end of the genome were upstream, T.sub.25V primer (Display Systems Biotech, Copenhagen, Denmark); and downstream, CM79: CTCCATGTGCCATGTACAGCAGAG (SEQ ID NO:2) for the first round and CM86: CTCGTCCACATGGCATCTCGAGAC (SEQ ID NO:3) for the nested PCR. The primers used for amplification of the 3' end of the genome were upstream, CM46: GCACTGGTGTCACTCTGTTG (SEQ ID NO:4) for the first round and CM80: GAGAAGGCTGAGGGTGATGCTGATG (SEQ ID NO:5) for the nested PCR and downstream, nls-: GACTTTCCGCTTCTTTTTAGG (SEQ ID NO:6). Reverse transcription PCR (RT-PCR) was was done with the Titan.TM. One Tube RT-PCR System (Boehringer Mannheim, Germany), using 2 .mu.g of total RNA as a template and following the manufacturer's instructions. The primers for amplification of the E.sup.ms coding region were upstream, CM28: GGAGAGAATATCACCCAGTG (SEQ ID NO:7); and downstream, CM21: CTCCACTCCGCAGTATGGACTTGC (SEQ ID NO:8).

The amplified RT-PCR products were purified by preparative agarose gel electrophoresis and eluti