Methods and devices for multiplexing amplification reactions Number:7,087,414 from the United States Patent and Trademark Office (PTO) owispatent The present invention provides a two-step multiplex amplification reaction wherein the first step truncates the standard initial multiplex amplification round to "boost" the sample copy number by only a 100 1000 fold increase in the target. Following the first step the product is divided into optimized secondary single amplification reactions, each containing one of the primer sets that were used previously in the first or multiplexed booster step. The booster step can occur using an aqueous target nucleic acid or using a solid phase archived nucleic acid. In particular, nucleic acid sequences that uniquely identify E. Coli were identified using the multiplex amplification method.<H amplification, multiplexing, Methods, and, dev, 7087414.html, Patent, pto, 7087414

Title: Methods and devices for multiplexing amplification reactions

Abstract: The present invention provides a two-step multiplex amplification reaction wherein the first step truncates the standard initial multiplex amplification round to "boost" the sample copy number by only a 100 1000 fold increase in the target. Following the first step the product is divided into optimized secondary single amplification reactions, each containing one of the primer sets that were used previously in the first or multiplexed booster step. The booster step can occur using an aqueous target nucleic acid or using a solid phase archived nucleic acid. In particular, nucleic acid sequences that uniquely identify E. Coli were identified using the multiplex amplification method.

Patent Number: 7,087,414 Issued on 08/08/2006 to Gerdes, et al.

Inventors: Gerdes; John C. (Denver, CO), Best; Elaine (Fort Collins, CO), Marmaro; Jeffery M. (Aurora, CO)
Assignee: Applera Corporation (Foster City, CA)

Appl. No.: 10/441,158

Filed: May 19, 2003

Related U.S. Patent Documents


Application Number	Filing Date	Patent Number	Issue Date
09589560	Jun., 2000	6605451

Current U.S. Class: 435/91.1 ; 435/91.2

Current International Class: C12P 19/34 (20060101)

Field of Search: 435/91.1,91.2

References Cited [Referenced By]

U.S. Patent Documents


4683195	July 1987	Mullis et al.
4683202	July 1987	Mullis
4965188	October 1990	Mullis et al.
5130238	July 1992	Malek et al.
5298392	March 1994	Atlas et al.
5354668	October 1994	Auerbach
5422252	June 1995	Walker et al.
5427930	June 1995	Birkenmeyer et al.
5437976	August 1995	Utermohlen
5455166	October 1995	Walker
5512430	April 1996	Gong
5538848	July 1996	Livak et al.
5582989	December 1996	Caskey et al.
5593838	January 1997	Zanaucchi et al.
5612473	March 1997	Wu et al.
5624825	April 1997	Walker et al.
5716784	February 1998	Di Cesare
5723591	March 1998	Livak et al.
5728526	March 1998	George, Jr. et al.
5736365	April 1998	Walker et al.
5738995	April 1998	Wu et al.
5750338	May 1998	Collins et al.
5843660	December 1998	Schumm et al.
5882856	March 1999	Shuber
5888736	March 1999	Lacroix et al.
5912148	June 1999	Eggerding
5952173	September 1999	Hansmann et al.
5955268	September 1999	Granados et al.
5981180	November 1999	Chandler et al.
5989809	November 1999	Stavrianopoulos
6001571	December 1999	Mandecki
6013440	January 2000	Lipshutz et al.
6090558	July 2000	Butler
2005/0048531	March 2005	Mittman et al.

Foreign Patent Documents


320308	Jun., 1989	EP
364255	Apr., 1990	EP
WO 97/19191	May., 1997	WO
WO 97/43441	Nov., 1997	WO
WO 98/46797	Oct., 1998	WO

Other References

Jayaraman, et al., BioTechniques, vol. 12, No. 3, pp. 392-398, Mar. 1992. cited by other .
Henegariu et al., BioTechniques, vol. 23, No. 3, p. 504-511, Sep. 1997. cited by other .
Liu et al., BioTechniques, vol. 25, No. 6, Sep. 1998. cited by other .
Tettelin et al., Genomics, vol. 62, pp. 500-507, 1999. cited by other .
International Search Report, PCT/US01/17901, Jan. 23, 2003. cited by other .
Lupu et al., J. Bacteriol. 103: 382-286, 1970. cited by other .
Graves and Swaminathan, Diagnostic Molecular Microbiology, Pershing et al., eds. ASM pp. 617-621, 1993. cited by other .
Bej, A.K. et al., Appl. Environ. Microbiol., 57(4):1013-1017, Apr. 1991. cited by other .
Green et al, J. Microbiol. Methods, 13:207-214, 1991. cited by other .
Rice, et al., J. Environ. Sci. Health, A30:1059-1067, 1995. cited by other .
Bej, et al., Appl. Environ. Microbiol., 56(2):307-314, Feb. 1990. cited by other .
Bej, A.K et al., Appl. Environ. Microbiol., vol. 57, No. 8, pp. 2429-2432, Aug. 1991. cited by other .
Min, J. et al., Anal. Biochem., 303:186-193, 2002. cited by other .
Sheridan, G.E.C., et al., Appl. Environ. Microbiol., vol. 64, pp. 1313-1318, 1998. cited by other .
Bej, A.K., et al., Molecular and Cellular Probes, vol. 4, pp. 353-365, 1990. cited by other .
Edwards, M.S., et al., PCR Methods and Applications, vol. 3, No. 4, pp. 565-575, Feb. 1994. cited by other .
Gonin, P., et al., Diagnostic Microbiology and Infectious Disease, vol. 37, No. 1, pp. 104, May 2000. cited by other .
Borg, K.L., et al., Molecular and Cellular Probes, vol. 9: pp. 251-257, 1995. cited by other .
Ruano, G., et al., "Nucleic Acids Research," vol. 17, No. 13 p. 5407, Jul. 1989. cited by other .
Ruano, G., et al. "Amplifications: A Forum for PCR Users," pp. 12-13, Sep. 1989. cited by other .
Picard, C., et al., "Applied and Environmental Microbiology," vol. 58, No. 9, pp. 2717-2722, Sep. 1992. cited by other .
Saulnier, P., et al., J. Clinical Microbiology, vol. 30, No. 8, pp. 2080-2083, Aug. 1992. cited by other .
Song, Y., et al., FEMS Microbiology Lett., Netherlands, vol. 187, No. 2, Jun. 2000. cited by other .
Waters, L.C., et al., Anal. Chem., vol. 70, No. 1, pp. 158-162, 1998. cite- d by other.

Primary Examiner: Horlick; Kenneth R.
Assistant Examiner: Wilder; Cynthia
Attorney, Agent or Firm: Hogan & Hartson L.L.P.

Government Interests

CONTRACTUAL ORIGIN OF THE INVENTION

This invention was made with Government support under contract number DAMD17-00-C-0001 awarded by the U.S. Army Medical Research Acquisition Activity. The Government has certain rights in the invention.

Parent Case Text

CROSS-REFERENCE TO OTHER APPLICATIONS

This patent application is a Continuation-in-Part application of U.S. patent application Ser. No. 09/589,560, filed Jun. 6, 2000, now U.S. Pat. No. 6,605,451 and entitled "Methods and Devices for Multiplexing Amplification Reactions," which is specifically incorporated herein by reference in its entirety.

Claims

The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. A method for discriminately identifying nucleic acid sequences of E. coli bacteria of the coliform species in a sample, comprising: (a) contacting said sample with a primer comprising a sequence identified by SEQ ID. NO 85; (b) amplifying said nucleic acid sequence; and (c) detecting said amplified nucleic acid sequence wherein said amplified nucleic acid sequence discriminately identifies E. coli bacteria.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention pertains to a two-step multiplex amplification reaction wherein the first step truncates a standard multiplex amplification round to "boost" the sample copy number by only a 100 1000 fold increase in the target. Following the first step of the present invention, the resulting product is divided into optimized secondary single amplification reactions, each containing one of the primer sets that were used previously in the first or multiplexed booster step. In particular, nucleic acid sequences that uniquely identify E. Coli were identified using the multiplex amplification method.

2. Description of the State of the Art

Nucleic acid hybridization assays are based on the tendency of two nucleic acid strands to pair at complementary regions. Presently, nucleic acid hybridization assays are primarily used to detect and identify unique DNA and RNA base sequences or specific genes in a complete DNA molecule in mixtures of nucleic acid, or in mixtures of nucleic acid fragments.

Since all biological organisms or specimens contain nucleic acids of specific and defined sequences, a universal strategy for nucleic acid detection has extremely broad applications in a number of diverse research and development areas as well as commercial industries. The identification of unique DNA or RNA sequences or specific genes within the total DNA or RNA extracted from tissue or culture samples may indicate the presence of physiological or pathological conditions. In particular, the identification of unique DNA or RNA sequences or specific genes, within the total DNA or RNA extracted from human or animal tissue, may indicate the presence of genetic diseases or conditions such as sickle cell anemia, tissue compatibility, cancer and precancerous states, or bacterial or viral infections. The identification of unique DNA or RNA sequences or specific genes within the total DNA or RNA extracted from bacterial cultures or tissue containing bacteria may indicate the presence of antibiotic resistance, toxins, viruses, or plasmids, or provide identification between types of bacteria.

The potential for practical uses of nucleic acid detection was greatly enhanced by the description of methods to amplify or copy, with fidelity, precise sequences of nucleic acid found at low concentration to much higher copy numbers, so that they are more readily observed by detection methods.

The original amplification method is the polymerase chain reaction described by Mullis, et al., in U.S. Pat. Nos. 4,683,195; 4,683,202 and 4,965,188, all of which are specifically incorporated herein by reference. Subsequent to the introduction of PCR, a wide array of strategies for amplification has been described. See, for example, U.S. Pat. No. 5,130,238 to Malek, entitled "Nucleic Acid Sequence Based Amplification (NASBA)"; U.S. Pat. No. 5,354,668 to Auerbach, entitled "Isothermal Methodology"; U.S. Pat. No. 5,427,930 to Buirkenmeyer, entitled "Ligase Chain Reaction"; and, U.S. Pat. No. 5,455,166 to Walker, entitled "Strand Displacement Amplification (SDA)," all of which are specifically incorporated herein by reference.

In general, diagnosis and screening for specific nucleic acids using nucleic acid amplification techniques has been limited by the necessity of amplifying a single target sequence at a time. In instances where any of multiple possible nucleic acid sequences may be present, performing multiple separate assays by this procedure is cumbersome and time consuming. For example, the same clinical symptoms generally occur due to infection from many etiological agents and therefore requires differential diagnosis among numerous possible target organisms. Cancer prognosis and genetic risk is known to be due to multiple gene alterations. Genetic polymorphism and mutations result from alterations at multiple loci and further demand determination of zygosity. In many circumstances the quantity of the targeted nucleic acid is limited so that dividing the specimen and using separate repeat analyses is often not possible. There is a substantial need for methods enabling the simultaneous analysis of multiple gene targets for the same specimen. In amplification-based methodologies, such methods are referred to as "multiplex reactions."

Chamberlain, et al., (Nucleic Acid Research, (1988) 16:11141 11156) first demonstrated multiplex analysis for the human dystrophin gene. Specific primer sets for additional genetic diseases or infectious agents have subsequently been identified. See, Caskey, et al., EP 364,255A3; Caskey, et al., U.S. Pat. No. 5,582,989; and Wu, et al., U.S. Pat. No. 5,612,473 (1997). The strategy for these multiplex reactions was accomplished by careful selection and optimization of specific primers. Developing robust, sensitive and specific multiplex reactions have demanded a number of specific design considerations and empiric optimizations. See, Edwards and Gibbs, PCR Methods Applic., (1994) 3:S65 S75; Henegariu, et al., Biotechniques, (1997) 23:504 511. This results in long development times and compromises reaction conditions that reduce assay sensitivity. Because each multiplex assay requires restrictive primer design parameters and empirical determination of unique reaction conditions, development of new diagnostic tests is very costly.

A number of specific problems have been identified that limit multiplex reactions. Incorporating primer sets for more than one target requires careful matching of the reaction efficiencies. If one primer amplifies its target with even slightly better efficiency, amplification becomes biased toward the more efficiently amplified target resulting in inefficient amplification of other target genes in the multiplex reaction. This is called "preferential amplification" and results in variable sensitivity and possible total failure of one or more of the targets in the multiplex reaction. Preferential amplification can sometimes be corrected by carefully matching all primer sequences to similar lengths and GC content and optimizing the primer concentrations, for example by increasing the primer concentration of the less efficient targets. One approach to correct preferential amplification is to incorporate inosine into primers in an attempt to adjust the primer amplification efficiencies (Wu, et al., U.S. Pat. No. 5,738,995 (1998)). Another approach is to design chimeric primers. Each primer contains a 3' region complementary to sequence-specific target recognition and a 5' region made up of a universal sequence. Using the universal sequence primer permits the amplification efficiencies of the different targets to be normalized. See, Shuber, et al., Genome Research, (1995) 5:488 493; and U.S. Pat. No. 5,882,856. Chimeric primers have also been utilized to multiplex isothermal strand displacement amplification (Walker, et al., U.S. Pat. Nos. 5,422,252, 5,624,825, and 5,736,365).

Since multiple primer sets are present, multiplexing is frequently complicated by artifacts resulting from cross-reactivity of the primers. In an attempt to avoid this, primer sequences are aligned using computer BLAST or primer design programs. All possible combinations must be analyzed so that as the number of targets increases this becomes extremely complex and severely limits primer selection. Even carefully designed primer combinations often produce spurious products that result in either false negative or false positive results. The reaction kinetics and efficiency is altered when more than one reaction is occurring simultaneously. Each multiplexed reaction for each different specimen type must be optimized for MgCl.sub.2 concentration and ratio to the deoxynucleotide concentration, KCl concentration, Taq polymerase concentration, thermal cycling extension and annealing times, and annealing temperatures. There is competition for the reagents in multiplex reactions so that all of the reactions plateau earlier. As a consequence, multiplexed reactions in general are less sensitive than the corresponding simplex reaction.

Another consideration to simultaneous amplification reactions is that there must be a method for the discrimination and detection of each of the targets. Generally, this is accomplished by designing the amplified product size to be different for each target and using gel electrophoresis to discriminate these. Alternatively, probes or the PCR products can be labeled so as to be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, using multiple fluorescent dyes incorporated with a self-quenching probe design amplification can be monitored in real time. See, Livak, et al., U.S. Pat. Nos. 5,538,848 and 5,723,591; and Di Cesare, U.S. Pat. No. 5,716,784. The number of multiplexed targets is further limited by the number of dye or other label moieties distinguishable within the reaction. As the number of different fluorescent moieties to be detected increases, so does the complexity of the optical system and data analysis programs necessary for result interpretation. Another approach is to hybridize the amplified multiplex products to a solid phase then detect each target. This can utilize a planar hybridization platform with a defined pattern of capture probes (Granados, et al., U.S. Pat. No. 5,955,268), or capture onto a beadset that can be sorted by flow cytometry (Chandler, et al., U.S. Pat. No. 5,981,180).

Due to the summation of all of the technical issues discussed, current technology for multiplex gene detection is costly and severely limited in the number and combinations of genes that can be analyzed. Generally, the reactions multiplex only two or three targets with a maximum of around ten targets. Isothermal amplification reactions are more complex than PCR and even more difficult to multiplex. See, Van Deursen, et al., Nucleic Acid Research, (1999) 27:e15.

There is still a need, therefore, for a method which permits multiplexing of large numbers of targets without extensive design and optimization constraints. There is also a further need for a method of detecting a significantly larger number of gene targets from a small quantity of initial target nucleic acid.

Coliform bacteria are introduced into water through either animal or human fecal contamination. Monitoring their levels is mandated to determine the microbiological quality of water. The standards for potable water include less than one total coliform in 100 milliliters potable water (Title 40, Code of Federal Regulations (CFR), 1995 rev, Part 141, National Primary Drinking Water Regulations). The coliform group of organisms includes bacteria of the Escherichia, Citrobacter, Klebsiella, and Enterobacter genera. However, Escherichia coli is the specific organism indicative of fecal contamination, since the other members of the coliform family can be found naturally in the environment. Current water testing methods detect coliforms as a group so that positive results must be confirmed to be E. coli using additional methods. The slow turnaround time for traditional culture detection and confirmation methods (days) results in delays in detecting contamination as well as in determining when the water is safe for redistribution or use. Accordingly, there is a need for a rapid monitoring assay specific for E. coli.

Traditional methods for detecting coliform bacteria rely upon culturing on a medium that selectively permits the growth of gram-negative bacteria and differentially detects lactose-utilizing bacteria (Van Poucke, et al. Appl. Environ. Microbiol. (1997) 63(2):771 4; Standard Methods for the Examination of Water and Wastewater, 19.sup.th ed., American Public Health Association, 1995). Since 1880, coliforms have been utilized as an indicator organism for monitoring the microbiological quality of drinking water. However, there are recognized deficiencies (Van Poucke, supra). This includes maintaining the viability of bacteria between the time of collection and enumeration, and the existence of chlorine stressed viable but non-culturable bacteria. False negatives can occur due to suppression of coliforms by high populations of other organisms or E. coli strains that are unable to ferment lactose (Edberg, et al. Appl Environ Microbiol. (1990) 56(2):366 9), and false positives occur due to other organisms that ferment lactose. Culture methods take 24 48 hours for initial coliform enumeration with an additional 24 hours for E. coli confirmation.

Escherichia coli is a member of the family Enterobacteriaceae and as such, shares much of its genomic sequence with other members of this family (Lampel, et al. Mol. Gen Genet. (1982) 186(1):82 6; Buvinger, et al. J Bacteriol. (1985) September; 163(3):850 7). For many purposes, it would be useful to specifically identify E. coli in the presence of other organisms, including members of the same family. However, because of the close conservation of sequence between E. coli and other Enterobacteria, amplification primers specific for E. coli are difficult to design.

Although there are gene-based methods described in the art for the detection of certain subsets of the coliform group, only a few of these claim to detect only E. coli. There are a number of studies that confirm coliform detection using uidA gene. Lupo et al. (J. Bacteriol. (1970) 103:382 386) detected uidA in 97.7% of 435 E. coli isolates, half from treated water and half from raw water. Graves and Swaminathan (Diagnostic Molecular Microbiology, (1993) Persing et. al., eds, ASM, p. 617 621) detected 100% of 83 confirmed environmental E. coli isolates using a uidA probe. Another study (Bej, et al. Appl Environ Microbiol. (1991) 57(4):1013 7) utilized uidA to detect 97% of 116 E. coli isolates. However, specificity studies investigating potentially cross-reactive organisms confirm that uidA probes detects both E. coli and some Shigella spp. (Bej, et al.(1991) supra; Green et.al., J. Microbiol. Methods (1991) 13:207 214; Rice et. al., J. Environ. Sci. Health A30:1059 1067, 1995).

Total coliforms can be detected using the lacZ gene that codes for beta-galactosidase (Bej, et al., Appl. Environ. Microbiol. (1990) 56(2):307 14; Bej, et al., Appl. Environ. Microbiol. (1991) 57(8):2429 32). Utilizing PCR amplification methods, Bej demonstrated limits of detection of 1 5 CFU in 100 ml of water. Atlas, et. al. disclose lacZ DNA sequences that identify coliform species of the genera Escherichia, Enterobacter, Citrobacter, and Klebsiella (U.S. Pat. No. 5,298,392).

Although Min and Bacumner (Anal. Biochem. (2002) 303:186 193) disclose sequences of the heat shock protein gene clpB, their publication only shows specificity compared to non-coliform genera and does not include cross-reaction data for other coliforms.

SUMMARY OF THE INVENTION

Accordingly, one aspect of this invention provides a method that permits the multiplex amplification of multiple targets without extensive design and optimization constraints. More specifically, this invention comprises a two-step multiplex amplification reaction wherein the first step truncates a standard multiplex amplification round thereby resulting in a product having a boosted target copy number while minimizing primer artifacts. The second step divides the resulting product achieved in the first step into optimized secondary single amplification reactions, each containing one of the primer sets that were used previously in the first step.

This invention further provides a method that enables amplification of multiple targets (or multiple amplification assays) from limited quantity specimens with very low nucleic acid copy number.

This invention further provides a diagnostic kit that allows the user to perform amplification of multiple targets without extensive design and optimization constraints and to amplify targets from limited quantity specimens with very low nucleic acid copy number.

This invention further discloses specific nucleic acid sequences that are unique to E. coli and which are located on the LacZ gene of E. coli. Accordingly, another aspect of this invention provides a method of detecting a single CFU of E. coli. More specifically, this invention provides a method of utilizing these specific sequences to detect 1 CFU of E. coli following NASBA amplification reactions without the need for long culture enrichment. This invention further includes a method of using IPTG induction to increase sensitivity in detecting the unique E. coli sequences disclosed herein.

Additional advantages and novel features of this invention shall be set forth in part in the description that follows, and in part will become apparent to those skilled in the art upon examination of the following specification or may be learned by the practice of the invention. The advantages of the invention may be realized and attained by means of the instrumentalities, combinations, compositions, and methods particularly pointed out in the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings, which are incorporated in and form a part of the specification, illustrate the preferred embodiments of the present invention, and together with the description serves to explain the principles of the invention.

In the Drawings:

FIG. 1 is a diagrammatic illustration of the limited multiplex amplification method of the present invention.

FIG. 2A is an illustration of an agarose gel showing the results of the experiment in Examples 1 and 2.

FIG. 2B is an illustration of an agarose gel showing the results of the experiment in Examples 1 and 2.

FIG. 2C is an illustration of an agarose gel showing the results of the experiment in Examples 1 and 2.

FIG. 2D is an illustration of an agarose gel showing the results of the experiment in Examples 1 and 2.

FIG. 3 is an illustration of an agarose gel showing the results of the experiment in Example 1 3.

FIG. 4 shows the detection results of a lateral flow assay of uninduced and induced E. coli culture.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

As discussed above, it would be tremendously useful if a method and diagnostic kit could be devised to multiplex multiple nucleic acid targets without the necessity of complex design constraints and extensive optimizations. The methods and diagnostic kit of the present invention generally involve the use of common multiplex amplification methods and reagents and are more specifically derived from the surprising discovery that if the nucleic acid sample to be analyzed is first pre-amplified so as to merely "boost" the samples copy number slightly, then the resulting product may be split into as many subsequent analysis reactions as required, and thereby circumventing the common limitations of standard multiplexing technology.

The present invention describes a novel method for boosting the amount of nucleic acid obtained from a broad range of biological samples for distribution among large numbers of individual analyses. It preferably involves the utilization of archived nucleic acid, bound irreversibly to a solid-phase material as the starting material. See U.S. application Ser. No. 09/061,757 and corresponding international application WO 98/46797, each of which is specifically incorporated herein by reference. The copy number of the irreversibly bond nucleic acid is then "boosted" by running a limited multiplex amplification reaction. The limited multiplex amplification reaction is a truncated version of any well known amplification methods such as, but not limited to PCR, RT-PCR, NASBA, SDA, TMA, CRCA, Ligase Chain Reaction, etc. Using archived nucleic acid has the advantage that multiple sequential rounds of the present invention may be performed. Alternatively, nucleic acids that are not bound but in aqueous solution may also be used. In this instance nucleic acid is obtained from the desired biological sample by a number of common procedures. These include phenol-chloroform and/or ethanol precipitation (Maniatis, et al., Molecular Cloning; A Laboratory Manual), high salt precipitation (Dykes, Electrophoresis (1989) 9:359 368), chex and other boiling methods (Walsh, et al., Biotechniques, (1991) 10:506 513 and other solid phase binding and elution (Vogelstein and Gillespie, Proc. Nat. Acad. Sci. USA, (1979) 76:615 619, etc. Output from these initial rounds of limited amplifications is distributed into the several single analyses.

As discussed above, it is desirable to be able to detect a single CFU of E. coli. Current methods for obtaining this level of sensitivity generally require culturing the organism overnight in order to reach detectable cell numbers. Both the lacZ beta-galactosidase (Bej, et al. Appl Environ. Microbiol. (1991) 57(8):2429 32; Sheridan, et al. Appl. Environ. Microbiol. (1998) 64:1313 1318) and the uidA beta glucoronidase enzymes (Vaitilingom, et al., Appl. Environ. Microbiol. (1998) 64:1157 1160; Berg and Fiksdal, Appl. Environ. Microbiol. (1988) 54:2118 2122; Tryland I, et al. Appl. Environ. Microbiol. (1998) 64(3):1018 23) have been shown to be readily inducible using environmental isolates. Lactose induction of membrane filter collected environmental isolates was shown to increase enzyme activity as much as 1000-fold resulting in detection limit of 100 CFU per 100 ml within 15 minutes of collection (Davies, et al., Lett. Appl. Microbiol. (1995) 21(2):99 102).

This invention provides a unique strategy to increase sensitivity by inducing the transcription of multiple mRNA copies within the E. coli cell in order to more rapidly reach detectable levels following NASBA amplification. Detection of a single CFU of E. coli is accomplished by diluting the bacteria suspended in water into an induction media with isopropyl .beta.-D-thiogalactopyranoside (IPTG) and incubating for about 2 6 hours to allow for mRNA transcription as described in detail in Example 3. The cells are lysed and released RNA bound to Xtra Amp.TM. tubes using the package insert directions (see also U.S. Pat. No. 6,291,166, which is specifically incorporated herein by reference). The solid phase captured RNA is amplified directly using the E. coli target recognition sequences disclosed herein that have been modified for NASBA amplification and lateral flow detection as described in U.S. Pat. No. 5,989,813 and U.S. patent application Ser. No. 09/705,043, each of which are specifically incorporated herein by reference.

In one preferred embodiment of the present invention, a sample containing tissue, cells or other biological material is treated in the presence of the solid phase binding material to release the nucleic acid contained in that sample. The solid phase archiving material allows amplification without elution of the bond nucleic acid. Once the sample nucleic acid is bound to the solid phase, the solid phase material is washed to remove lysis buffer conditions, and to prepare for amplification conditions. A reaction mixture appropriate to the amplification method is added to the solid phase or allowed to contact the solid phase. The number of primer pairs used according to the present invention may be any number greater than two; however, since the standard multiplexing reaction conditions and designs become more difficult and less effective as the number of primers used increases the present invention is most helpful as the number of primers utilized is over five.

This reaction mixture contains the amplification primers for several independent amplifications. This is similar to standard multiplex PCR with the following exceptions: first, in the preferred embodiment, the primer concentrations will be very low. The effective primer concentrations should be limited to allow only a few logs of amplification but definitely the primer concentration should be exhausted before reaction plateau is reached. Second, the number of amplification cycles should also be minimized. The goal of this first phase of multiplex amplification or "Booster Amp" is to allow only a sufficient amount of amplification to proceed in order to allow the resultant reaction mix to be split up and redistributed into at least the same number of subsequent simples amplification reactions as there are independent primer pairs in the first amplification.

This initial round of amplification, or Booster Amp should only proceed into early logarithmic phase of the amplification, and in no instance proceed until reaction plateau is reached. Once the Booster Amp is complete, the resultant reaction mix with the multiple amplification species is removed from contact with the solid phase and distributed into several secondary amplifications. These amplifications could be equal to or greater than the number of primer pairs employed in the first Booster Amp. Each of these secondary amplification reactions will contain only one primer pair. This primer pair may be identical to one of the primer pairs in the Booster Amp or may be "nested" within one of the primer pairs of the Booster Amp. Either way, each secondary amplification reaction will use the input material from the Booster amplification as a target source. In the secondary amplification, normal amounts of primer will be used, and amplification will be allowed to proceed normally. A detection system for normal detection of a single amplification product such as, but not limited to radioactive isotopes, or visual markers such as biotin may be included in the secondary amplification.

In the preferred embodiment the reaction takes place in the presence of a solid phase material as discussed previously. The advantage of this is that the original solid phase material with the bond nucleic acid may be rinsed following the first Booster Amp and re-initialized for a second, subsequent Booster Amp employing a new mix of amplification primers. The process is then repeated through an additional secondary amplification. The entire process can be repeated for numerous rounds. Consequently, in the event the quantity of nucleic acid sample being analyzed is low, the analysis may be performed as often and as thoroughly as need be. Alternatively, the Booster Amp step may be performed in aqueous condition where the nucleic acid is unbound.

FIG. 1 illustrates the concept for microwell based PCR (but can apply to any primer-based amplification method utilizing a polymerase, such as but not limited to DNA polymerase, RNA polymerase, transcriptase, or Q.beta. replicase in any form of an appropriate container). A chip or card containing the reaction wells or chambers (not shown) is contained in a device capable of performing the correct thermocycling. Lysed sample is introduced into extraction chamber 10, where the freed nucleic acid can bind to the solid phase material within extraction chamber 10. The chamber 10 having bound the sample is incubated is step 12 for a short period (10 20 minutes). An aqueous buffer, preferably PCR buffer is then used in washing step 14. The wash 14 removes lysate and initializes the chamber 10' in step 16 for PCR conditions. The first multiplex PCR reaction mixture (containing multiplexed primers, PCR buffer, and Taq Polymerase) is introduced to the chamber 10 and cycled in step 18. The multiplex products 20' should be sub-detectable, but amplified to a level no greater than the plateau of the reaction and preferably in the range of 100 to 1000-fold. The Booster PCR reaction 20' is then split into the secondary PCR chambers 22'. Reaction mixtures (having a single primer pair) for each of the simplex, secondary PCR reactions (not shown) are introduced previously, or at this point. Cycling is performed on the chip or card to allow the secondary PCR reactions 22' to proceed to completion. The initial sample chamber is now empty, and it can be washed at step 24 and re-initialized for a second round of Booster/Secondary PCRs.

This invention includes nucleic acid sequences that are substantially homologous to the SEQ. ID. NO. 99. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%.

This invention reveals a robust and simple method for multiplex amplification of large numbers of gene targets. The invention teaches that preferably 2 40 or more primer sets can be combined to permit multiplex amplification if they are in low concentration and limited to an initial amplification round that results in only a 100 1000 fold increase in target. However, it should be understood that any number of primer sets greater than two may be used according to the present invention. This has been designated as a "booster round" or booster amp and can occur using an aqueous target nucleic acid or using solid phase archived nucleic acid. As discussed above, the advantage of using archived material is that multiple booster rounds can be performed from the same archived specimen. For example, performing five, 20-target booster rounds from archived nucleic acid would permit the analysis of 100 different genes. Following each booster round the amplification product is diluted into optimized secondary single PCR reactions, each containing one of the primer sets that were multiplexed in the booster reaction. These simplex reactions can be optimized for maximum sensitivity and each requires only one method of detection, for example single dye homogeneous detection. The invention enables multiplexing without extensive optimization and is robust enough to permit random selection of the primers to be multiplexed.

The invention overcomes the usual technical problems of multiplexing. By limiting the multiplexed cycles, preferential amplification and cross-reaction of the multiple primers is minimized. Only the single PCR reactions need to be optimized. The simplex reaction has maximum sensitivity since reagent competition does not occur. By using the simplex PCR the detection probe does not have to be multiplexed. The potential to randomly combine the multiplexed primers provides for maximum flexibility and cost effectiveness since this allows custom selection of the targets to be multiplexed. Frequently, the targets that need to be multiplexed can vary for a particular geographic location, laboratory, type of patient, or type of specimen. Since archived nucleic acid can be reanalyzed the multiplex can be designed in a logical algorithm. For example, in booster reaction detection set number one, identify the most frequently known mutations. Then only if these are not detected is it necessary to perform additional multiplexes for the more rare mutations. This enables economical yet comprehensive genetic analysis.

The invention is further illustrated by the following non-limited examples. All scientific and technical terms have the meanings as understood by one of ordinary skill in the art. The specific examples which follow illustrate the various multiplexing amplification methods that the present invention may be adapted to work with and are not to be construed as limiting the invention in sphere or scope. The methods may be adapted to variation in order to function with other commonly used multiplex amplification methods embraced by this invention but not specifically disclosed. Further, variations to the methods to produce the same results in somewhat different fashion will be evident to one skilled in the art.

All temperatures are understood to be in degrees Centigrade (.degree. C.) when not specified. Melting temperatures (Tm) of the primers were estimated using the generally accepted mathematical calculation based upon the formula Tm=81.5+16.6.times.log(Na.sup.+)(41.times.(#G+#C)/length)-500/length. Amplification techniques, including multiplexing amplification techniques, are now sufficiently well known and widespread so as to be considered routine. All polymerase enzymes and nucleotides can be purchased from PE (Biosystems, Foster City, Calif.). PCR was carried out in a buffer containing (50 mM KCl, 10 mM Tris, pH 8.3, 2.0 mM Mg.sup.2+) for 30 cycles of 1 minute at 94.degree. C., for 2 minutes at 55.degree. C. and at 72.degree. C. with a 5 second increment added to the 72.degree. C. elongation step at every cycle. This procedure was carried out in a DNA Thermal Cycler (Perkin-Elmer Cetus catalog No. N8010150).

EXAMPLE 1

Multiplex Amplification Incorporating Booster PCR and Archiving

1. Primer Design:

The Xtra Amp.TM. Extraction Kit (Xtrana, Inc.) provides an innovative system for nucleic acid extraction in which the nucleic acid remains bound in the extraction tube and can be directly amplified by PCR in this same tube. The unique principle underlying this system lies in the proprietary nucleic acid binding matrix, Xtra Bind.TM.. Xtra Bind.TM. is a non-silica matrix which stably and irreversibly binds both DNA and RNA. The Xtra Amp.TM. kit contains 96 (as 1.times.8 strips) 0.2 mL size microcentrifuge tubes coated with the Xtra Bind.TM. matrix, cell lysis buffer and wash buffer. The kit is commercially available currently for extraction of genomic DNA from, whole blood (manufactured and distributed for Xtrana, Inc. by ANSYS Diagnostics, Lake Forest, Calif.). For demonstrating Xtra Plex feasibility, the Xtra Amp.TM. Blood kit was chosen as the extraction platform. For the PCR multiplexing experiments it was decided to obtain twenty five primer pairs to allow their use in various groupings. Three primer sets from the Lifecodes Corporation (Stanford, Conn.) HLA Primers (HLA-A: Primer A1 (catalog No. 164011); Primer A2 (catalog No. 164012); HLA-B: Primer B1 (catalog No. 165011), Primer B2 (catalog No. 165012; DR.beta.: Primer A (catalog No. 160031); Primer B (catalog No. 160032) were added to twenty three in-house primer sets, shown below in Table 1, that were designed for human gene targets to make the total of twenty five sets. The genes targeted are as follows: Human cytoplasmic beta-actin gene (accession M10277); Homo sapiens interleukin 2 precursor (IL2) gene (accession J00264); Human growth hormone gene (HGH-N) (accession M13438); Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (accession J04038); Homo sapiens dystrophin (DMD) gene (accession AF214530); Homo sapiens G protein-coupled receptor 57 (GPR57) gene (accession AF112461); Human galactokinase (GALK1) gene (accession L76927); Homo sapiens MHC class 1 region (accession AF055066). The primer pairs were designed using the primer design software OLIGO 5.0 (Molecular Biology Insights). The sizes of the amplification products are designed to allow discrimination by agarose gel electrophoresis. No special considerations were given to normalizing the melting temperatures of the primer pairs, or to eliminating structural interactions between primers from different pairs. PCR primer design considerations such as avoiding hairpins and dimers between the forward and reverse primers of each set were accommodated in the design as for any typical PCR primer design. The resultant primers had melting temperatures ranging from 49.degree. C. to 72.degree. C. When examining the dimer formation potential between primers from different pairs, some serious dimer potential was seen in some cases. This was largely ignored since this approach was believed to be able to overcome such potential artifacts and it was considered important to demonstrate this. The primers and sequences are shown in Table 1.

TABLE-US-00001 TABLE 1 Primer SED ID Amplicon Pair NO. Sequence Name TM Length Group 1 1 1 CGAGGCCCAGAGCAA HBAPCR1-FP 58 100 2 GGTGTGGTGCCAGATTT HBAPCR1-RP 57 100 2 3 GTTTAATCAGAGCCACA IL2 = PCR2-FP 52 187 4 GGAAAGGTAGGTCAAGA IL2 PCR2-RP 54 187 3 5 GTCTTGCATTGCACTAA IL2-OLD-fp 52 257 6 TAAATGTGAGCATCCTG IL2-OLD-rp 52 257 4 7 CTGTGGAGGGCAGCTGTGGCTT hGH PCR1-FP 68 450 8 GCGGGCGGATTACCTGAGGTCA hGH PCR1-RP 68 450 5 Lifecodes HLA-A, A1 HLA-A-A1 N/A 910 Lifecodes HLA-A, A2 HLA-A-A2 N/A 910 Group 2 6 9 TCAGCAGAGAAGCCTAA IL2-PCR1-FP 54 120 10 ATCCCTACCCCATCAT IL2-PCR1-RP 54 120 7 11 CAAAAGTCCTCCCAAAG IL2-PCR3-FP 54 197 12 TGCCATCTATCACAATCC IL2-PCR3-RP 55 197 8 13 AAGGGTCATCATCTCTGC GAPDH I5 fp 57 259 14 CTTCCACGATACCAAAGTT GAPDH I5 rp 55 259 9 15 CGCTTTAAGTTATTTGTGTC HDYST3-FP 54 400 16 GTTTCCTTTTAAGGGTATTC HDYST3-RP 54 400 10 Lifecodes HLA-B, B1 HLA-B-B1 N/A 1100 Lifecodes HLA-B, B2 HLA-B-B1 N/A 1100 Group 3 11 17 CATCTACGAGGGGTATG HBAPCR2-FP 57 120 18 GCCGTGGTGGTGA HBAPCR2-RP 54 120 12 19 GTTTGCCTTTTATGGTAATAAC HBAPCR4-FP 55 161 20 GTGAGCTGCGAGAA HBAPCR4-RP 54 161 13 21 GAGTCCACTGGCGTCTTCAC GAPDH FP 64 233 22 AGGCTGTTGTCATACTTCTC GAPDH RP 58 233 14 23 CCACCCCCTTAAAGAAA IL2-PCR4-FP 54 346 24 GGCAGGAGTTGAGGTTA IL2-PCR4-RP 57 346 15 25 GCGGGGAGGAGGAAAGGAATAG hGHPCR2-FP 66 500 26 CAGGACACATTGTGCCAAAGGG hGHPCR2-RP 64 500 Group 4 16 27 CCACTATTCGGAAACTT HGP57R1-FP 52 130 28 TGTATGGCATAATGACA HGP57R1-RP 49 130 17 29 GAGTCGAGGGATGGCTAGGT HDYST1-FP 64 150 30 TTCAAAGTGGGATGAGGAGG HDYST1-RP 60 150 18 31 GGACTGCCACCTTCTACC HGKPCR2-FP 62 215 32 GACACCCAAGCATACACC HGKPCR2-RP 59 215 19 33 GCAGATGAGCATACGCTGAGTG hGHPCR3-FP 64 600 34 CGAGGGGAAATGAAGAATACGG hGHPCR3-RP 62 600 20 Lifecodes DR-.beta., A DR-.beta., A N/A 287 Lifecodes DR-.beta., B DR-.beta., B N/A 287 Group 5 21 35 AGGGGAGGTGATAGCAT HBAPCR3-FP 57 140 36 AAGTTGGGGGACAAAA HBAPCR3-RP 51 140 22 37 CCGGTGCCATCTTCCATA HGKPCR1-FP 68 170 38 CCTGCCTTGCCCATTCTT HGKPCR1-RP 68 170 23 39 GAGGGGAGAGGGGGTAA HBAPCR5-FP 62 228 40 CGGCGGGTGTGGA HBAPCR5-RP 57 228 24 41 GGCTGCTTTTAACTCTGG GAPDH FP 57 270 42 CACTCCTGGAAGATGGTGATGG GAPDH RP 64 270 25 43 CTCATTCTCTAGCCAAATCT HDYST2-FP 56 300 44 CCTCGACTCACTCTCCTC HDYST2-RP 62 300 New Primers 26 45 CTATCGCCATCTAAGCCCAGTA HGH PCR4-fp 62 450 46 CTGCCTGCATTTTCACTTCA HGH PCR4-Rp 58 450

2. Sequential Booster Reaction of Solid-Phase Captured Nucleic Acid.

In these multiplexing experiments, (the results of which are demonstrated in FIGS. 2a 2d) designed to show feasibility for performing multiple rounds of multiplexing amplification, each booster amplification consisted of a PCR reaction with five primer sets. In the first 5-plex experiment, Group 2 primers were used. In the second experiment group 4 primers were used, and in the third, group 1 primers were used. In the 20-plex experiment, the primers used were selected from all 5 groups each at one-fiftieth normal concentration (4 nM as opposed to 200 nM). The nucleotide triphosphate, buffer and salt concentrations were normal. Cycling conditions were chosen as a compromise between the theoretically optimal conditions for each of the primer pairs (each cycle: 72.degree. C., 30 seconds; 55.degree. C., 1 minute; and 65.degree. C., 3 minutes). The total number of cycles was limited to ten. The primers were first mixed in 1:1 ratios to each and then diluted to one-fiftieth of the normal 10.times. concentration. The PCR reaction mix for the booster reaction was made up as per normal. The Xtra Amp.TM. kit (discussed previously) was used with fresh human blood as per the kit protocol. The booster reactions were placed into the Xtra Amp.TM. tubes as would a normal PCR. Following the booster PCR, the reaction mixture was removed and diluted 5-fold.

To each simplex, secondary reaction 5 microliters of this diluted booster product was added. Each secondary reaction had only one of the 5 primer pairs and was set up normally with normal amounts of primer. These PCRs were run for the full 40 cycles. Two cycling profiles (72.degree. C., 30 seconds; 65.degree. C., or 1 minute; 72.degree. C., 3 minutes) were used for these secondary reactions. The same cycling profile used in the booster reactions was used for all secondary PCRs. In cases where the primers were believed to require higher temperatures, additional secondary reactions were run using higher temperature profiles (each cycle: 72.degree. C., 30 seconds; 65.degree. C., 1 minute; 72.degree. C., 3 minutes).

Next, the Xtra Amp.TM. tube in which the booster reaction was performed was rinsed three times with Wash Buffer supplied in the kit. A second booster PCR reaction mixture with a different set of five primer pairs was added to the tube. Identical conditions were used as in the first booster amplification. The product was removed and diluted as before, and aliquoted into the next group of five secondary, simplex PCRs using the same primer pairs as in the second booster PCR. All of these secondary reactions were run using the same cycling profile as the booster, with some primers being additionally run at the higher temp profile as well. Following this, a third round of booster/secondary simplex reactions were run with a third grouping of five primers in identical conditions to the first two rounds.

For comparison, a normal, 40-cycle multiplex PCR was run using each of the five primer pair groupings. Each of these had five primer pairs each in the same groupings as the booster PCRs. These multiplex reactions were run with half-normal primer concentration for 40 cycles. The products from all fifteen secondary reactions, the high-temp additional secondary reactions and the three normal multiplexing PCRs were analyzed by agarose gel electrophoresis.

FIG. 2A demonstrates the results of the first round of the secondary PCR reactions. Five PCRs were used in first round (Group 2: IL2-1; IL2-3; GAPDH 15; HDYST3; HLA-B) booster PCR. The Booster PCR was performed in an Xtra Amp.TM. tube following extraction of nucleic acids from human blood. Following booster amplification, product was diluted 1:5, then 1:10 volume of this was added to six subsequent reactions in separate normal PCR tubes. The six subsequent simplex secondary reactions included all five of the Booster PCR systems, with an additional system (HLA-A) whose primers were similar to one of the five (HLA-B). The additional PCR served as a secondary PCR control and was expected to be negative. The results shown in FIG. 2A demonstrate that all five PCRs from Booster worked in the secondary simplex reactions. In contrast, a normal multiplex PCR (MMX) in which all five primer pairs were run in a similarly prepared Xtra Amp.TM. tube for a total of 40 cycles did not work for all PCR products. (In this and all gel images pictured, the reference ladder is in 100 base-pair increments starting at 100 bp L is ladder, nt is no template and t is template).

FIG. 2B demonstrates the results of the second round of the secondary PCR reaction. The second round of 5-primer pair booster PCR was run in the same Xtra Amp.TM. tube as was the first booster. The tube was washed three times with Xtra Amp.TM. kit wash buffer prior to the addition of the second booster multiplex PCR mix. The next five primer pairs were from Group 4: HGP57; HDYST-1; HGK-2; HGH-3, and DRB. Following an identically run booster PCR, the product was diluted 1:5 as before and aliquoted into the five secondary simplex PCR reactions. These reactions were run at the low temperature cycling range. The results shown in FIG. 2B demonstrates that the four reactions worked at this temperature with some spot contamination in one of the HDYST-1 no-template controls. The HGP57 and HGH-3 secondary reactions work best at the high temperature secondary cycling protocol and were done at that temperature as well. A normal PCR multiplex (MMX) with these same primers in an Xtra Amp.TM. tube failed again.

FIG. 2C demonstrates the results of the third round of the secondary PCR reactions. In this experiment, a third 5-primer pair booster multiplex was performed in the same Xtra Amp.TM. tube as was the first two booster reactions, discussed above, using primer sets from group 1 (HBA PCR 1; IL2 PCR 2; IL2 PCR-old; hGH PCR 1 and HLA-A). Again, three standard washes were done with the tube between the previous booster PCR and this one. The standard 40-cycle multiplex with these primers failed with these primers as well. The results shown in FIG. 2C demonstrates that some contamination in the no template controls was seen in the IL2-OLD primer reaction, and the hGH-1 PCR did not work well with the low temperature cycling condition set for the secondary reactions. Both the hGH-1 and HLA-A secondary reactions were run at the high temperature secondary cycling condition set (65.degree. C. and 72.degree. C. vs. 55.degree. C. and 65.degree. C.).

The results shown in FIG. 2D demonstrates that in this set of secondary reactions, the primer sets which appeared to be compromised in the first sets of secondary reactions were rerun using higher annealing and extension temperatures (65.degree. C. and 72.degree. C. vs. 55.degree. C. and 65.degree. C., respectively). The contamination issue with IL2-OLD was still apparent (this primer set had been used previously in our lab). The remaining PCR reactions were much more robust.

The results indicate that all of the secondary reactions worked. In one case where a primer pair had been used extensively in this lab prior to these experiments (IL2-OLD) there appeared some contamination in the no template controls. One primer pair gave weak positive results (HGP-57). Four primer pairs worked better at the higher temperature secondary PCR profile. One primer pair worked better at higher concentration in the secondary reaction. These results indicate that the secondary PCR reactions function as normal PCR reactions in which some optimization will give better results. The booster PCR was able to function adequately at less than optimal conditions for the various primer sets. In contrast, the three normal multiplex PCRs that were run as multiplex amplifications for the full 40 cycles failed to show amplification products for all but a few primer sets.

3. Multiplex Capability Enabled by Booster PCR:

Since the two-step PCR approach in which a limited-booster PCR is used to boost the target copy prior to aliquoting the boosted product into the individual secondary PCRs worked so well with groups of 5 primer pairs, increasing the number of primer pairs in the booster reaction was performed. A 20-primer pair booster reaction was set up using identical conditions as before