N-(4-sulfonylaryl)cyclylamine-2-hydroxyethylamines as beta-3 adrenergic receptor agonists Number:6,743,787 from the United States Patent and Trademark Office (PTO) owispatent This invention provides compounds of Formula I having the structure ##STR1##wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, W, X, and Y are as defined hereinbefore or a pharmaceutically acceptable salt thereof, which are useful in treating metabolic disorders related to insulin resistance or hyperglycemia.<H hydroxyethylamines, sulfonylaryl, N, 4, sulfonylary, 6743787.html, Patent, pto, 6743787

Title: N-(4-sulfonylaryl)cyclylamine-2-hydroxyethylamines as beta-3 adrenergic receptor agonists

Abstract: This invention provides compounds of Formula I having the structure ##STR1##wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, W, X, and Y are as defined hereinbefore or a pharmaceutically acceptable salt thereof, which are useful in treating metabolic disorders related to insulin resistance or hyperglycemia.

Patent Number: 6,743,787 Issued on 06/01/2004 to Sum, et al.

Inventors: Sum; Fuk-Wah (Pomona, NY), Malamas; Michael Sotirios (Jamison, PA)
Assignee: Wyeth (Madison, NJ)

Appl. No.: 10/205,019

Filed: July 25, 2002

Related U.S. Patent Documents


Application Number	Filing Date	Patent Number	Issue Date
904114	Jul., 2001	6444685

Current U.S. Class: 514/210.01 ; 514/426; 548/557; 548/953

Current International Class: C07D 211/00 (20060101); C07D 211/58 (20060101); C07D 401/12 (20060101); C07D 401/14 (20060101); C07D 417/14 (20060101); C07D 417/00 (20060101); C07D 401/00 (20060101)

Field of Search: 514/210.01,426 548/953,557

References Cited [Referenced By]

U.S. Patent Documents


5561142	October 1996	Fisher et al.
5578620	November 1996	Fujita et al.
5614523	March 1997	Audia et al.
5741789	April 1998	Hibschman et al.
5786356	July 1998	Bell et al.
5789402	August 1998	Audia et al.
6069176	May 2000	Tsuchiya et al.

Foreign Patent Documents


0 449 261	Oct., 1991	EP
0 659 737	Jun., 1995	EP
0 714 883	Jun., 1996	EP
0 764 640	Mar., 1997	EP
WO 99/25687	May., 1999	WO
WO 99/65895	Dec., 1999	WO
WO 01/17989	Mar., 2001	WO
WO 01/43744	Jun., 2001	WO
WO 01/44227	Jun., 2001	WO

Other References

Marc S. Berridge et al., Nucl. Med. Biol., 1992, 563-569, 19(5). .
Joan M. Caroon et al., J. Pharm. Sci., Jan. 1987, 32-34, 76(1). .
A. Guy et al., Synthesis, Sep. 1992, 821-22. .
Manabu Hori et al., J. Org. Chem., 1998, 889-894, 63. .
Yunsheng Huang et al., J. Med. Chem., 1998, 2361-2370, 41. .
Bernard Hulin et al., J. Med., Chem., 1992, 1853-1864, 35. .
Carl Kaiser et al., J. Med. Chem., 1977, 687-692, 20(5). .
Yutaka Kawashima et al., Chem. Pharm. Bull, 1995, 1132-1136, 43(7). .
Kiyoto Koguro et al., Synthesis, 1998, 910-914. .
Gerard Leclerc et al., J. Med. Chem., 1980, 738-744, 23(7). .
D. Mauleon et al., I1 Farmaco, 1989, 1109-1117, 44(11). .
Alexander McKillop et al., J. Am. Chem. Soc., Sep. 1971, 4919-4920, 93(19). .
Ricardo Tapia et al., Synthetic Communications, 1986, 681-687, 16(6). .
Edward C. Taylor et al., Synthesis, Aug. 1981, 606-608. .
Michiaki Tominaga et al., Chem. Pharm. Bull, 1987, 3699-3704, 35(9). .
R.H. Uloth et al., J. Med. Chem., 1966, 88-97, 9. .
Paul C. Unangst et al., J. Med. Chem., 1994, 322-328, 37. .
Sophie Vanwetswinkel et al., J. Antibiotics, Sep. 1994, 1041-1051, 47(9). .
S. Tamada et al., JP01061468 A2 (English abstract), 1989. .
Baihua HU et al., J. Med. Chem., 2001, 1456-1466, 44..

Primary Examiner: Kifle; Bruck
Attorney, Agent or Firm: Hild; Kimberly R. Milowsky; Arnold S.

Parent Case Text

This is a divisional of application(s) Ser. No. 09/904,114 filed on Jul. 12, 2001 now U.S. Pat. No. 6,444,695, which claims the benefit of Provisional Application Serial No. 60/218,589, filed Jul. 17, 2000, the entire disclosure of which is hereby incorporated by reference.

Claims

What is claimed is:

1. A compound of formula I having the structure ##STR12##

wherein: W is (CH.sub.2).sub.m ; X is (CH.sub.2).sub.n ; Y is OCH.sub.2, SCH.sub.2, or a bond; R.sub.1 is phenyl substituted with R.sub.5 and R.sub.6, or Het substituted with R.sub.5 and R.sub.6 ; R.sub.2 is hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, or alkynyl of 2-7 carbon atoms; R.sub.4 is alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms; cycloalkyl of 3-8 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, Het substituted with R.sub.5 and R.sub.6, aryloxy, --NHCOR.sub.7, --NR.sub.8 R.sub.8, --CR.sub.3 R.sub.5 R.sub.6, arylamino, Het-amino, arylalkylamino having 1-6 carbon atoms in the alkyl chain, Het-alkylamino having 1-6 carbon atoms in the alkyl chain, alkoxycarbonylalkyl of 3-13 carbon atoms, carboxyalkyl of 2-7 carbon atoms, alkylcarbonylalkyl of 3-13 carbon atoms, arylcarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-carbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminocarbonylalkyl of 2-7 carbon atoms, alkylaminocarbonylalkyl of 3-13 carbon atoms, arylaminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminosulfonylalkyl of 1-6 carbon atoms, alkylsulfonylalkyl of 2-12 carbon atoms, arylsulfonylalkyl having 1-6 carbon atoms in the alkyl chain, alkylaminosulfonylalkyl of 2-12 carbon atoms, arylaminosulfonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminosulfonylalkyl having 1-6 carbon atoms in the alkyl chain, phosphonylalkyl of 1-6 carbon atoms, or phosphorylalkyl of 1-6 carbon atoms; R.sub.3, R.sub.5, and R.sub.6, are each, independently, hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, cycloalkyl of 3-8 carbon atoms, aryl, Het, arylalkyl having 1-6 carbon atoms in the alkyl chain, Het-alkyl having 1-6 carbon atoms in the alkyl chain, halogen, cyano, nitro, hydroxy, alkoxy of 1-6 carbon atoms, aryloxy, arylalkyloxy having 1-6 carbon atoms in the alkyl chain, alkylthio of 1-6 carbon atoms, arylthio, arylamino, Het-amino, arylalkylamino of 1-6 carbons in the alkyl chain, Het-alkylamino having 1-6 carbon atoms in the alkyl chain, hydroxyamino, --NHCOR.sub.7, --NHSO.sub.2 R.sub.7, --NHP(O)(R.sub.7).sub.2, --COR.sub.8, --SO.sub.2 R.sub.8, --NR.sub.8 R.sub.8, carboxy, alkylcarbonyl of 2-7 carbon atoms, formylalkyl of 2-7 carbon atoms, phosphoryl, alkoxycarbonylalkyl of 3-13 carbon atoms, carboxyalkyl of 2-7 carbon atoms, alkylcarbonylalkyl of 2-13 carbon atoms, arylcarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-carbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminocarbonylalkyl of 2-7 carbon atoms, alkylaminocarbonylalkyl of 3-13 carbon atoms, arylaminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminosulfonylalkyl of 1-6 carbon atoms, alkylsulfonylalkyl of 2-12 carbon atoms, arylsulfonylalkyl having 1-6 carbon atoms in the alkyl chain, alkylaminosulfonylalkyl of 2-12 carbon atoms, arylaminosulfonylalkyl of 1-6 carbon atoms, Het-aminosulfonylalkyl of 1-6 carbon atoms, phosphonylalkyl of 1-6 carbon atoms, or phosphorylalkyl of 1-6 carbon atoms; or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; R.sub.7 is hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, cycloalkyl of 3-8 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, aryl, alkoxy of 1-6 carbon atoms, --NR.sub.8 R.sub.9, or --NR.sub.9 (CH.sub.2).sub.p --R.sub.8 ; R.sub.8 is hydrogen, alkoxy of 1-6 carbon atoms, alkyl of 1-6 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, arylalkoxy having 1-6 carbon atoms in the alkyl chain, --CR.sub.3 R.sub.5 R.sub.6, --(CH.sub.2).sub.p --COR.sub.9, or --(CH.sub.2).sub.p --R.sub.9 ; R.sub.9 is hydrogen, hydroxy, alkyl of 1-6 carbon atoms, cycloalkyl of 3-8 carbon atoms, alkoxy of 1-6 carbon atoms, aryl substituted with R.sub.5 and R.sub.6, Het substituted with R.sub.5 and R.sub.6, arylalkoxy having 1-6 carbon atoms in the alkyl chain, or --NR.sub.10 R.sub.10 ; R.sub.10 is hydrogen, alkyl of 1-6 carbon atoms, alkoxycarbonyl of 2-7 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, or Het substituted with R.sub.5 and R.sub.6 ; Het is a monocyclic or bicyclic heterocycle of 5-10 ring atoms, having 1-4 heteroatoms selected from oxygen, nitrogen, and sulfur; wherein the heterocycle may be saturated, unsaturated, or partially unsaturated; and may be optionally fused to a phenyl ring; m is 1-3; n is 1-3; wherein m+n is 2 or 3; is 0-6; or a pharmaceutically acceptable salt thereof.

2. The compound according to claim 1, wherein R.sub.2 is hydrogen; R.sub.4 is alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, cycloalkyl of 3-8 carbon atoms, aryl substituted with R.sub.4 and R.sub.5, Het substituted with R.sub.5 and R.sub.6, --NR.sub.8 R8, or --CR.sub.3 R.sub.5 R.sub.6 ; R.sub.3, R.sub.5, and R.sub.6 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, halogen, hydroxy, alkoxy of 1-6 carbon atoms, arylalkoxy having 1-6 carbon atoms in the alkyl chain, arylalkyl having 1-6 carbon atoms in the alkyl chain, Het-alkyl having 1-6 carbon atoms in the alkyl chain, --NHCOR.sub.7, --NHSO.sub.2 R.sub.7, --NR.sub.8 R.sub.8, --COR.sub.8, formylalkyl of 2-7 carbon atoms, or alkoxycarbonylalkyl of 3-13 carbon atoms, or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; Het is (a) a 6-membered saturated, partially unsaturated, or unsaturated heterocycle containing 1-2 nitrogens, optionally fused to a phenyl ring; (b) a 5-membered saturated, partially saturated, or unsaturated heterocycle containing 1-3 nitrogen, oxygen, or sulfur atoms, optionally fused to a phenyl ring; (c) a saturated, partially unsaturated, or unsaturated bicyclic heterocycle containing 1-4 nitrogen, oxygen, or sulfur atoms; (d) carbazole, dibenzofuran, and dibenzothiophene; wherein one or more of the ring carbon atoms of Het as described in (a), (b), or (c) may be a carbonyl moiety, where the ring does not contain a double bond in the position corresponding to that carbon atom; or a pharmaceutically acceptable salt thereof.

3. The compound of claim 2, wherein Y is OCH.sub.2 or a bond; R.sub.2 is hydrogen; R.sub.4 is aryl substituted with R.sub.4 and R.sub.5, Het substituted with R.sub.5 and R.sub.6, --NR.sub.8 R8, or --CR.sub.3 R.sub.5 R.sub.6 ; R.sub.3, R.sub.5, and R.sub.6 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, halogen, hydroxy, alkoxy of 1-6 carbon atoms, arylalkoxy having 1-6 carbon atoms in the alkyl chain, --NHSO.sub.2 R.sub.7, --NR.sub.8 R.sub.8, --COR.sub.8, formylalkyl of 2-7 carbon atoms, or alkoxycarbonylalkyl of 3-13 carbon atoms, or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; Het is pyridine, pyrimidine, furan, imidazolyl, thiazole, oxazole, isoxazole, pyrazole, triazole, tetrazole, carbazole, pyrrole, thiophene, imidazole, imidazol-2-one, imidazole-2-thione, imidazolidine-2,4-dione, pyrazoline, triazole, tetrazole, oxazolone, oxadiazole, imidazolone, thiazole, thiazolone, thiadiazole, thiadiazolone, thiazoladine-2,4-dione, piperazine, pyrazine, pyrrolidine, piperidine, morpholine, benzofuran, dibenzofuran, dibenzothiophene, isobenzofuran, indole, isoindole, benzothiophene, 1,3,-dihydrobenzoimidazol-2-one, benzo[1,2,5]thiadiazole, 2-oxo-2,3-dihydro-1H-benzoimidazole, quinoline, or isoquinoline; or a pharmaceutically acceptable salt thereof.

4. A method of treating metabolic disorders mediated by insulin resistance or hyperglycemia in a mammal in need thereof which comprises providing to said mammal, an effective amount of at least one compound of claim 1 or a pharmaceutically acceptable salt thereof.

5. A method of treating or inhibiting type II diabetes in a mammal in need thereof which comprises providing to said mammal, an effective amount of at least one compound of claim 1 or a pharmaceutically acceptable salt thereof.

6. A method of modulating glucose levels in a mammal in need thereof which comprises providing to said mammal, an effective amount of at least one compound of claim 1 or a pharmaceutically acceptable salt thereof.

7. A method of treating or inhibiting urinary incontinence in a mammal in need thereof which comprises providing to said mammal an effective amount of at least one compound of claim 1 or a pharmaceutically acceptable salt thereof.

8. A method of treating or inhibiting atherosclerosis, gastrointestinal disorders, neurogenic inflammation, glaucoma, or ocular hypertension in a mammal in need thereof, which comprises providing to said mammal an effective amount of at least one compound of claim 1 or a pharmaceutically acceptable salt thereof.

9. A pharmaceutical composition which comprises at least one compound of claim 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutical carrier.

Description

BACKGROUND OF THE INVENTION

This invention relates to N-(4-sulfonylaryl)cyclylamine 2-hydroxyethylamine derivatives which are .beta..sub.3 adrenergic receptor agonists useful for the treatment of metabolic disorders related to insulin resistance or hyperglycemia (typically associated with obesity or glucose intolerance), atherosclerosis, gastrointestinal disorders, neurogenetic inflammation, glaucoma, ocular hypertension, and and frequent urination, and are particularly useful in the treatment or inhibition of type II diabetes.

The subdivision of .beta. adrenergic receptors (.beta.-AR) into .beta..sub.1 - and .beta..sub.2 -AR has led to the development of .beta..sub.1 - and .beta..sub.2 -antagonists and/or agonists which have been useful for the treatment of cardiovascular disease and asthma. The recent discovery of "a typical" receptors, later called .beta..sub.3 -AR, has led to the development of .beta..sub.3 -AR agnoists which may be potentially useful as antiobesity and antidiabetic agents. For recent reviews on .beta..sub.3 -AR agnoists, see: 1. A. D. Strosberg, Annu. Rev. Pharmacol. Toxicol. 1997, 37, 421; 2. A. E. Weber, Ann. Rep. Med. Chem. 1998, 33, 193; 3. C. P. Kordik and A. B. Reitz, J. Med. Chem. 1999, 42, 181; 4. C. Weyer, J. F. Gautier and E. Danforth, Diabetes and Metabolism, 1999, 25, 11.

Compounds that are potent and selective .beta..sub.3 agonists, may be potentially useful antiobesity agents. Low levels or lack of .beta..sub.1 and .beta..sub.2 -agonistic properties will minimize or eliminate the adverse side effects that are associated with .beta..sub.1 and .beta..sub.2 agonistic activities, i.e. increased heart rate, and muscle tremor, respectively.

Early developments in the .beta..sub.3 -agonist field are described in European patent 427480, U.S. Pat. Nos. 4,396,627, 4,478,849, 4,999,377, 5,153,210. Although the early developments purport to claim compounds with greater .beta..sub.3 -AR selectivity over the .beta..sub.1 - and .beta..sub.2 -AR. However, clinical trials in humans with those early developed .beta..sub.3 -agonists have, so far, not been successful.

More recently, potent and selective human .beta..sub.3 agonists have been described in several patents and published applications: WO 98/32753, WO 97/46556, WO 97/37646, WO 97/15549, WO 97/25311, WO 96/16938, WO 95/29159, European Patents 659737, 801060, 714883, 764640, 827746, and U.S. Pat. Nos. 5,561,142, 5,705,515, 5,436,257, and 5,578,620. These compounds were evaluated in Chinese hamster ovary (CHO) cells test procedures, expressing cloned human .beta.3 receptors, which predict the effects that can be expected in humans (Granneman et al., Mol Pharmacol., 1992, 42, 964; Emorine et al., Science, 1989, 245, 111.8; Liggett Mol. Pharmacol., 1992, 42, 634).

.beta..sub.3 -Adrenergic agonists also are useful in controlling the frequent urge of urination. It has been known that relaxation of the bladder detrusor is under beta adrenergic control (Li J H, Yasay G D and Kau S T Pharmacology 1992; 44: 13-18). Beta-adrenoceptor subtypes are in the detrusor of guinea-pig urinary bladder. Recently, a number of laboratories have provided experimental evidence of .beta..sub.3 adrenergic receptors in a number of animal species including human (Yamazaki Y, Takeda H, Akahane M, Igawa Y, et al. Br. J. Pharmacol. 1998; 124: 593-599), and that activation of the .beta..sub.3 receptor subtype by norepinephrine is responsible for relaxation of the urinary bladder.

Urge urinary incontinence is characterized by abnormal spontaneous bladder contractions that can be unrelated to bladder urine volume. Urge urinary incontinence is often referred to hyperactive or unstable bladder. Several etiologies exist and fall into two major categories, myogenic and neurogenic. The myogenic bladder is usually associated with detrusor hypertrophy secondary to bladder outlet obstruction, or with chronic urinary tract infection. Neurogenic bladders are associated with an uninhibited micturition reflex. An upper motor neuron disease is usually the underlying cause. In either case, the disease is characterized my abnormal spontaneous contractions that result in an abnormal sense of urinary urgency and involuntary urine loss. At present, the most common therapy for hyperactive bladder includes the use of antimuscarinic agents to block the action of the excitatory neurotransmitter acetylcholine. While effective in neurogenic bladders, their utility in myogenic bladders is questionable. In addition, due to severe dry mouth side-effects associated with antimuscarinic therapy, the patient compliance with these agents is only approximately 30%.

In the bladder, .beta..sub.3 adrenergic receptor agonists activate adenylyl cyclase and generate cAMP through the G-protein coupled .beta..sub.3 receptor. The resulting phosphorylation of phospholamban/calcium ATPase enhances uptake of calcium into the sarcoplasmic reticulum. The decrease in intracellular calcium inhibits bladder smooth muscle contractility.

It is suggested therefore, that activation of the .beta..sub.3 adrenergic receptor in the urinary bladder will inhibit abnormal spontaneous bladder contractions and be useful for the treatment of bladder hyperactivity. Note, that unlike the antimuscarinics, .beta..sub.3 adrenergic receptor agonists would be expected to be active against both neurogenic and myogenic etiologies.

Despite all these recent developments there is still no single therapy available for the treatment of type II diabetes (NIDDM), obesity, atherosclerosis, gastrointestinal disorders, neurogenetic inflammation, frequent urination and related diseases. A potent and selective .beta..sub.3 adrenergic receptor agonist is therefore highly desirable for the potential treatment of such disease states.

DESCRIPTION OF THE INVENTION

This invention provides compounds of Formula I having the structure ##STR2##

wherein: W is (CH.sub.2).sub.m ; X is (CH.sub.2).sub.n ; Y is OCH.sub.2, SCH.sub.2, or a bond; R.sub.1 is phenyl substituted with R.sub.5 and R.sub.6, or Het substituted with R.sub.5 and R.sub.6 ; R.sub.2 is hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, or alkynyl of 2-7 carbon atoms; R.sub.4 is alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, cycloalkyl of 3-8 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, Het substituted with R.sub.5 and R.sub.6, aryloxy, --NHCOR.sub.7, --NR.sub.8 R.sub.8, --CR.sub.3 R.sub.5 R.sub.6, arylamino, Het-amino, arylalkylamino having 1-6 carbon atoms in the alkyl chain, Het-alkylamino having 1-6 carbon atoms in the alkyl chain, alkoxycarbonylalkyl of 3-13 carbon atoms, carboxyalkyl of 2-7 carbon atoms, alkylcarbonylalkyl of 3-13 carbon atoms, arylcarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-carbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminocarbonylalkyl of 2-7 carbon atoms, alkylaminocarbonylalkyl of 3-13 carbon atoms, arylaminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminosulfonylalkyl of 1-6 carbon atoms, alkylsulfonylalkyl of 2-12 carbon atoms, arylsulfonylalkyl having 1-6 carbon atoms in the alkyl chain, alkylaminosulfonylalkyl of 2-12 carbon atoms, arylaminosulfonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminosulfonylalkyl having 1-6 carbon atoms in the alkyl chain, phosphonylalkyl of 1-6 carbon atoms, or phosphorylalkyl of 1-6 carbon atoms; R.sub.3, R.sub.5, and R.sub.6, are each, independently, hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, cycloalkyl of 3-8 carbon atoms, aryl, Het, arylalkyl having 1-6 carbon atoms in the alkyl chain, Het-alkyl having 1-6 carbon atoms in the alkyl chain, halogen, cyano, nitro, hydroxy, alkoxy of 1-6 carbon atoms, aryloxy, arylalkyloxy having 1-6 carbon atoms in the alkyl chain, ailkylthio 1-6 carbon atoms, arylthio, arylamino, Het-amino, arylalkylamino of 1-6 carbons in the alkyl chain, Het-alkylamino having 1-6 carbon atoms in the alkyl chain, hydroxyamino, --NHCOR.sub.7, --NHSO.sub.2 R.sub.7, --NHP(O)(R.sub.7).sub.2, --COR.sub.8, --SO.sub.2 R.sub.8, --NR.sub.8 R.sub.8, carboxy, alkylcarbonyl of 2-7 carbon atoms, formylalkyl of 2-7 carbon atoms, phosphoryl, alkoxycarbonylalkyl of 3-13 carbon atoms, carboxyalkyl of 2-7 carbon atoms, alkylcarbonylalkyl of 2-13 carbon atoms, arylcarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-carbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminocarbonylalkyl of 2-7 carbon atoms, alkylaminocarbonylalkyl of 3-13 carbon atoms, arylaminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, Het-aminocarbonylalkyl having 1-6 carbon atoms in the alkyl chain, aminosulfonylalkyl of 1-6 carbon atoms, alkylsulfonylalkyl of 2-12 carbon atoms, arylsulfonylalkyl having 1-6 carbon atoms in the alkyl chain, alkylaminosulfonylalkyl of 2-12 carbon atoms, arylaminosulfonylalkyl of 1-6 carbon atoms, Het-aminosulfonylalkyl of 1-6 carbon atoms, phosphonylalkyl of 1-6 carbon atoms, or phosphorylalkyl of 1-6 carbon atoms; or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; R.sub.7 is hydrogen, trifluoromethyl, alkyl of 1-6 carbon atoms, cycloalkyl of 3-8 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, aryl, alkoxy of 1-6 carbon atoms, --NR.sub.8 R.sub.9, or --NR.sub.9 (CH.sub.2).sub.p -R.sub.8 R.sub.8 is hydrogen, alkoxy of 1-6 carbon atoms, alkyl of 1-6 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, arylalkoxy having 1-6 carbon atoms in the alkyl chain, --CR.sub.3 R.sub.5 R.sub.6, --(CH.sub.2).sub.p --COR.sub.9, or --(CH.sub.2).sub.p -R.sub.9 ; R.sub.9 is hydrogen, hydroxy, alkyl of 1-6 carbon atoms, cycloalkyl of 3-8 carbon atoms, alkoxy of 1-6 carbon atoms, aryl substituted with R.sub.5 and R.sub.6, Het substituted with R.sub.5 and R.sub.6, arylalkoxy having 1-6 carbon atoms in the alkyl chain, or --NR.sub.10 R.sub.10 ; R.sub.10 is hydrogen, alkyl of 1-6 carbon atoms, alkoxycarbonyl of 2-7 carbon atoms, hydroxy, aryl substituted with R.sub.5 and R.sub.6, or Het substituted with R.sub.5 and R.sub.6 ; Het is a monocyclic or bicyclic heterocycle of 5-10 ring atoms, having 1-4 heteroatoms selected from oxygen, nitrogen, and sulfur; wherein the heterocycle may be saturated, unsaturated, or partially unsaturated; and may be optionally fused to a phenyl ring; m is 1-3; n is 1-3; p is 0-6; or a pharmaceutically acceptable salt thereof, which are selective agonists at human .beta..sub.3 adrenergic receptors and are useful as antidiabetic, antihyperglycemic, and antiobesity agents.

Pharmaceutically acceptable salts can be formed from organic and inorganic acids, for example, acetic, propionic, lactic, citric, tartaric, succinic, fumaric, maleic, malonic, mandelic, malic, phthalic, hydrochloric, hydrobromic, phosphoric, nitric, sulfuric, methanesulfonic, napthalenesulfonic, benzenesulfonic, toluenesulfonic, camphorsulfonic, and similarly known acceptable acids when a compound of this invention contains a basic moiety. Salts may also be formed from organic and inorganic bases, such as alkali metal salts (for example, sodium, lithium, or potassium) alkaline earth metal salts, ammonium salts, alkylammonium salts containing 1-6 carbon atoms or dialkylammonium salts containing 1-6 carbon atoms in each alkyl group, and trialkylammonium salts containing 1-6 carbon atoms in each alkyl group, when a compound of this invention contains an acidic moiety.

Alkyl includes both straight chain as well as branched moieties. By definition alkyl also includes alkyl moieties which are optionally mono- or poly substituted with groups such as halogen, hydroxy, cyano, alkoxy, aryloxy, arylalkyl, alkylthio, arylthio, amino, alkylamino, and dialkylamino. Halogen means bromine, chlorine, fluorine, and iodine. Where a substituent contains one or more moieties which have the same designation (i.e., --NR.sub.8 R.sub.8), each of the moieties can be the same or different.

Preferred aryl moieties include phenyl or naphthyl. Preferred Het moieties include: (a) 6-membered saturated, partially unsaturated, or unsaturated heterocycles containing 1-2 nitrogens, optionally fused to a phenyl ring; (b) 5-membered saturated, partially saturated, or unsaturated heterocycles containing 1-3 nitrogen, oxygen, or sulfur atoms, optionally fused to a phenyl ring; (c) saturated, partially unsaturated, or unsaturated bicyclic heterocycles containing 1-4 nitrogen, oxygen, or sulfur atoms; (d) carbazole, dibenzofuran, and dibenzothiophene. In the Het of categories (a), (b), and (c), ring carbon atoms may be carbonyl moieties, where the ring does not contain a double bond in that position (for example, thiazolidine-2,4-dione).

More preferred Het rings include pyridine, pyrimidine, furan, imidazolyl, thiazole, oxazole, isoxazole, pyrazole, triazole, tetrazole, carbazole, pyrrole, thiophene, imidazole, imidazol-2-one, imidazole-2-thione, imidazolidine-2,4-dione, pyrazoline, triazole, tetrazole, oxazolone, oxadiazole, imidazolone, thiazole, thiazolone, thiadiazole, thiadiazolone, thiazoladine-2,4-dione, pyridine, pyrimidine, piperazine, pyrazine, pyrrolidine, piperidine, morpholine, benzofuran, dibenzofuran, dibenzothiophene, isobenzofuran, indole, isoindole, benzothiophene, 1,3,-dihydrobenzoimidazol-2-one, benzo[1,2,5]thiadoazole, 2-oxo-2,3-dihydro-1H-benzoimidazole, quinoline, and isoquinoline. Particularly preferred Het include pyrrolidine, piperazine, piperidine, thiazole, imidazolidine-2,4-dione, carbazole, and 2-oxo-2,3-dihydro-1H-benzoimidazole. It is understood that Het do not contain heteroatoms in arrangements which would make them inherently unstable. For example, the term Het does not include ring systems containing O--O bonds in the ring backbone.

The compounds of the present invention contain at least one asymmetric center. Additional asymmetric centers may exist on the molecule depending upon the structure of the substituents on the molecule. The compounds may be prepared as a racemic mixture and can be used as such, or may be resolved into the. In addition to covering the racemic compounds, this invention also covers all individual isomers, enantiomers, diasteromers or mixtures thereof, regardless of whether the structural representations of the compounds indicate such stereochemistry.

Preferred compounds of Formula I are those in which R.sub.2 is hydrogen; R.sub.4 is alkyl of 1-6 carbon atoms, alkenyl of 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, cycloalkyl of 3-8 carbon atoms, aryl substituted with R.sub.4 and R.sub.5, Het substituted with R.sub.5 and R.sub.6, --NR.sub.8 R8, or --CR.sub.3 R.sub.5 R.sub.6 ; R.sub.3, R.sub.5, and R.sub.6 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, alkenyl fo 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, halogen, hydroxy, alkoxy of 1-6 carbon atoms, arylalkoxy having 1-6 carbon atoms in the alkyl chain, hydroxy, arylalkyl having 1-6 carbon atoms in the alkyl chain, Het-alkyl having 1-6 carbon atoms in the alkyl chain, --NHCOR.sub.7, --NHSO.sub.2 R.sub.7, --NR.sub.8 R.sub.8, --COR.sub.8, formylalkyl of 2-7 carbon atoms, or alkoxycarbonylalkyl of 3-13 carbon atoms, or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; Het is (a) a 6-membered saturated, partially unsaturated, or unsaturated heterocycle containing 1-2 nitrogens, optionally fused to a phenyl ring; (b) a 5-membered saturated, partially saturated, or unsaturated heterocycle containing 1-3 nitrogen, oxygen, or sulfur atoms, optionally fused to a phenyl ring; (c) a saturated, partially unsaturated, or unsaturated bicyclic heterocycle containing 1-4 nitrogen, oxygen, or sulfur atoms; (d) carbazole, dibenzofuran, and dibenzothiophene; wherein one or more of the ring carbon atoms of Het as described in (a), (b), or (c) may be a carbonyl moiety, where the ring does not contain a double bond in the position corresponding to that carbon atom; or a pharmaceutically acceptable salt thereof.

More preferred compounds of Formula I are those in which Y is OCH.sub.2 or a bond; R.sub.2 is hydrogen; R.sub.4 is aryl substituted with R.sub.4 and R.sub.5, Het substituted with R.sub.5 and R.sub.6, --NR.sub.8 R8, or --CR.sub.3 R.sub.5 R.sub.6 ; R.sub.3, R.sub.5, and R.sub.6 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, alkenyl fo 2-7 carbon atoms, alkynyl of 2-7 carbon atoms, halogen, hydroxy, alkoxy of 1-6 carbon atoms, arylalkoxy having 1-6 carbon atoms in the alkyl chain, hydroxy, --NHSO.sub.2 R.sub.7, --NR.sub.8 R.sub.8, --COR.sub.8, formylalkyl of 2-7 carbon atoms, or alkoxycarbonylalkyl of 3-13 carbon atoms, or R.sub.5 and R.sub.6 may be alkylene groups that are taken together to form a 3-8 membered cycloalkyl ring when R.sub.5 and R.sub.6 are attached to a common carbon atom; Het is pyridine, pyrimidine, furan, imidazolyl, thiazole, oxazole, isoxazole, pyrazole, triazole, tetrazole, carbazole, pyrrole, thiophene, imidazole, imidazol-2-one, imidazole-2-thione, imidazolidine-2,4-dione, pyrazoline, triazole, tetrazole, oxazolone, oxadiazole, imidazolone, thiazole, thiazolone, thiadiazole, thiadiazolone, thiazoladine-2,4-dione, pyridine, pyrimidine, piperazine, pyrazine, pyrrolidine, piperidine, morpholine, benzofuran, dibenzofuran, dibenzothiophene, isobenzofuran, indole, isoindole, benzothiophene, 1,3,-dihydrobenzoimidazol-2-one, benzo[1,2,5]thiadoazole, 2-oxo-2,3-dihydro-1H-benzoimidazole, quinoline, or isoquinoline; or a pharmaceutically acceptable salt thereof.

Specifically preferred compounds of this invention are: a) N-Benzyl-N-(3,4-dimethoxy-phenyl)-4-{-4-[2-hydroxy-3-(2-oxo-2,3-dihydro-1H -benzoimidazol-4-yloxy)-propylamino]-piperidin-1-yl}-benzenesulfonamide; b) N-Benzyl-N-butyl-4-{4-[(2S)-2-hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazo l-4-yloxy)-propylamino]-piperidin-1-yl}-benzenesulfonamide c) N-Benzyl-N-butyl-4-{4-[2-hydroxy-2-(4-hydroxy-3-methanesulfonylamino-pheny l)-ethylamino]-piperidin-1-yl}-benzenesulfonamide; d) N-Benzyl-4-{4-[2-hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)-pr opylamino]-piperidin-1-yl}-benzenesulfonamide; e) N-Benzyl-4-{4-[2-hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethyl amino]-piperidin-1-yl}-benzenesulfonamide; f) N-Benzyl-4-{4-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-piperidin -1-yl}-benzenesulfonamide; g) N-(3,4-Dimethoxy-phenyl)-4-{4-[(2S)-2-hydroxy-3-(2-oxo-2,3-dihydro-1H-benz oimidazol-4-yloxy)-propylamino]-piperidin-1-yl}-benzenesulfonamide; h) N-(3,4-Dimethoxy-phenyl)-4-{4-[2-hydroxy-2-(4-hydroxy-3-methanesulfonylami no-phenyl)-ethylamino]-piperidin-1-yl}-benzenesulfonamide; i) 4-{4-[(2S)-3-(4-Benzyloxy-phenoxy)-2-hydroxy-propylamino]-piperidin-1-; j) yl}-N-(3,4-dimethoxy-phenyl)-benzenesulfonamide; k) 4-{(4-[(2S)-3-(9H-Carbazol-4-yloxy)-2-hydroxy-propylamino]-piperidin-1-yl} -N-(3,4-dimethoxy-phenyl)-benzenesulfonamide; l) N-(3,4-Dimethoxy-phenyl)-4-{4-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propyl amino]-piperidin-1-yl}-benzenesulfonamide; m) N-Butyl-4-{4-[(2S)-2-hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy )-propylamino]-piperidin-1-yl}-benzenesulfonamide; n) N-Butyl-4-{4-[(2S)-3-(9H-carbazol-4-yloxy)-2-hydroxy-propylamino]piperidin -1-yl}-benzenesulfonamide; o) N-Butyl-4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylaminophenyl)-et hylamino]-piperidin-1-yl}-benzenesulfonamide; p) 1-(4-{4-[2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)ethylamino]- piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid isopropyl ester; q) 1-(4-{4-[2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)propylami no]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid isopropyl ester; r) 1-(4-{4-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)prop ylamino]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid methylamide; s) 1-(4-{4-[2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)ethylamino]- piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid; t) [Butyl-(4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylaminophenyl)-et hylamino]piperidin-1-yl}-benzenesulfonyl)-amino]-acetic acid benzyl ester; u) [Butyl-(4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylaminophenyl)-et hylamino]-piperidin-1-yl}-benzenesulfonyl)-amino]-acetic acid; v) (2R)-1-(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)et hylamino]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid benzyl ester; w) (2S)-1-(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)et hylamino]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-2-carboxylic acid benzyl ester; x) [Butyl-(4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-e thylamino]-piperidin-1-yl}-benzenesulfonyl)-amino]-acetic acid ethyl ester-1-yl}-phenyl)-amino]-acetic acid; y) N-(2-Hydroxyethyl)-4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylamin o-phenyl)-ethylamino]-piperidin-1-yl}-benzenesulfonamide; z) [(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylam ino]-piperidin-1-yl}-benzenesulfonyl)-methyl-amino]-acetic acid ethyl ester; aa) N-Cyclopropylmethyl-4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylami no-phenyl)-ethylamino]-piperidin-1-yl}-benzenesulfonamide; bb) 4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylamin o]-piperidin-1-yl}-N-isobutyl-benzenesulfonamide; cc) [Cyclopropylmethyl-(4-{(4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylam ino-phenyl)-ethylamino]-piperidin-1-yl}-benzenesulfonyl)-amino]-acetic acid ethyl ester; dd) 4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylamin o]-piperidin-1-yl}-N-isopropyl-benzenesulfonamide; ee) 1-(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethyla mino]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-(2R)-2-carboxylic acid ethyl ester; ff) [Cyclopropylmethyl-(4-{4-[(2R)-2-hydroxy-2-(4-hydroxy-3-methanesulfonylami no-phenyl)-ethylamino]-piperidin-1-yl}-benzenesulfonyl)-amino]-acetic acid; gg) [(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylam ino]-piperidin-1-yl}-benzenesulfonyl)-isobutyl-amino]-acetic acid ethyl ester; hh) [(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylam ino]-piperidin-1-yl}-benzenesulfonyl)-methyl-amino]-acetic acid; ii) [(4-{4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethylam ino]-piperidin-1-yl}-benzenesulfonyl)-isobutyl-amino]-acetic acid; jj) 1-(4-{(4-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethyl amino]-piperidin-1-yl}-benzenesulfonyl)-pyrrolidine-(2R)-2-carboxylic acid; kk) ethyl(2S)-1-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino] phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]-2-pyrrolidinecarboxylate ; ll) ethyl(2S)-2-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino ]phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}-4-methylpentanoat e; mm) ethyl(2S)-2-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino ]phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino)-3-methylbutanoate ; nn) (2S)-1-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]pheny l}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]-2-pyrrolidinecarboxylic acid; oo) ethyl 1-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-nyl}phenyl)sulfonyl]amino}cyclop entanecarboxylate; pp) N-{2-hydroxy-5-[(1R)-1-hydroxy-2-({1-[4-(1-pyrrolidinylsulfonyl)phenyl]-4- lidinylsulfonyl)phenyl]-4-piperidinyl}amino)ethyl]phenyl}methanesulfonamide ; qq) N-{2-hydroxy-5-[(1R)-1-hydroxy-2-({1-[4-(1-piperidinylsulfonyl)phenyl]-4-i dinylsulfonyl)phenyl]-4-piperidinyl}amino)ethyl]phenyl}methanesulfonamide; rr) Ethyl 1-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-inyl}phenyl)sulfonyl]amino}cyclo hexanecarboxylate; ss) Ethyl [[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-idinyl}phenyl)sulfonyl](isopropyl) amino]acetate; tt) N-[2-Hydroxy-5-(1-hydroxy-2-{1-[4-(toluene-4-sulfonyl)-phenyl]-piperidin-4 -ylamino}-ethyl)-phenyl]-methanesulfonamide; uu) 4-((2S)-2-Hydroxy-3-{1-[4-(toluene-4-sulfonyl)-phenyl]-piperidin-4-ylamino }-propoxy)-1,3-dihydro-benzoimidazol-2-one; vv) 2-(2-butynyl)-2-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)am ino]-phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]-4-hexynoicacid tert-butyl ester; ww) 2-(2-butynyl)-2-[(4-{(4-[((2R)-2-hydroxy-2-{(4-hydroxy-3-[(methylsulfonyl) amino]-phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]-4-hexynoic acid; xx) 1-(4-(4-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)prop ylamino]-piperidin-1-yl}-benzenesulfonyl)-imidazolidine-2,4-dione; yy) N-[5-((1R)-2-{(1-[4-(2,4-Dioxo-imidazolidine-1-sulfonyl)-phenyl]piperidin- 4-ylamino}-1-hydroxy-ethyl)-2-hydroxy-phenyl]-methanesulfonamide; zz) 1-(4-{(4-((2S)-2-Hydroxy-2-(2-trifluoromethyl-thiazol-4-yl)-ethylamino]-pi peridin-1-yl}-benzenesulfonyl)-imidazolidine-2,4-dione; aaa) tert-Butyl 2-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-((methylsulfonyl)amino]phenyl}et hyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}acetate; bbb) 2-{[(4-{(4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phenyl}e thyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}acetic acid; ccc) tert-Butyl 2-{[2-(tert-butoxy)-2-oxoethyl][(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(me thylsulfonyl)amino]phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino} acetate; ddd) 2-{(Carboxymethyl)[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl) amino]phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino)acetic acid; eee) Ethyl 2-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phenyl}et hyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}acetate; fff) Methyl 2-{[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phenyl}et hyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}acetate; ggg) Ethyl 2-{[(4-{4-[((2R)-2-hydroxy-2-(4-hydroxy-3-[(methylsulfonyl)amino]phenyl}et hyl)amino]piperidin-1-yl}phenyl)sulfonyl]amino}acetylcarbamate; hhh) tert-Butyl [[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3[(methylsulfonyl)amino]phenyl}ethyl )amino] piperidin-1-yl}phenyl)sulfonyl](methoxycarbonyl)amino]acetate; iii) [[(4-{4-[((2R)-2-Hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phenyl}ethy l)amino]piperidin-1-yl}phenyl)sulfonyl](methoxycarbonyl)amino]acetic acid; iii) Ethyl ((2,5-difluorobenzyl)[(4-[4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfon yl)amino]phenyl}ethyl)amino]piperidin-1-yl}phenyl)sulfonyl]amino}acetate; kkk) 1-[4-({[(Butylamino)carbonyl]amino}sulfonyl)phenyl]-4-[((2R)-2-hydroxy-2-{ 4-hydroxy-3-[(methylsulfonyl)amino]phenyl}ethyl)amino]piperidine; lll) 2-{(2,5-Difluorobenzyl)[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulf onyl)amino]phenyl}ethyl)amino]-1-piperidinyl}phenyl)sulfonyl]amino}acetic acid; mmm) Ethyl {4-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phenyl}et hyl)amino]piperidin-1-yl)phenyl)sulfonyl]piperazin-1-yl}acetate; nnn) {4-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]-phenyl}e thyl)amino]piperidin-1-yl}phenyl)sulfonyl]piperazin-1-yl}acetic acid; ooo) N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[(1-{4-[(4-methylpiperazin-1-yl)sulfonyl] phenyl}piperidin-4-yl)amino]ethyl}phenyl)methanesulfonamide; ppp) tert-Butyl {(2,5-difluorobenzyl)[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfon yl)amino]phenyl}ethyl)amino]piperidin-1-yl)phenyl)sulfonyl]amino}acetate; or a pharmaceutically acceptable salt thereof; and (4-[(4-{4-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]-phenyl}et hyl)amino]piperidin-1-yl)phenyl)sulfonyl]piperazin-1-yl}acetic acid, sodium salt.

The compounds of this invention were be prepared according to the following schemes from commercially available starting materials or starting materials which can be prepared using literature procedures. These schemes show the preparation of representative compounds of this invention. ##STR3## ##STR4## ##STR5## ##STR6## ##STR7## ##STR8## ##STR9##

In general, as shown in Scheme 1, compounds of the present invention are prepared by reductive amination of N-(4-sulfonylaryl)-substituted oxo-cyclylamines with the appropriate aryl-substituted ethanolamines. Various oxo-cycylamine derivatives can be prepared according to one of the synthetic Schemes 2 to 7.

Many of the aryloxypropanolamines and arylethanolamines used in Scheme 1 are commerically available or readily prepared by known methods [e.g., 1. A. Guy, Synthesis, 1992, 821; 2. A. A. Asselin, J. Med. Chem., 1986,1009; 3. M. S. Berridge et al., Nucl. Med. Biol., 19, 1992, 563; 4. C. D. Jesudason, et al., EP0764640; 5. EP0659737.]. In one method (Scheme 8), equimolar amounts of a substituted phenol and (2S) or (2R)-glycidyl 3-nitrobenzenesulfonate are dissolved in an organic solvent such as acetone or dimethylformamide and treated with a base such as sodium hydride or potassium carbonate for 0.5 to 24 hours at temperatures of 20 to 100.degree. C. to provide the corresponding aryloxyoxiranes. The aryloxyoxiranes are converted to the ethanolamines by regioselective ring opening of the oxirane with lithium azide in a solvent such as hexamethylphosphoramide, followed by reduction with triphenylphosphine or hydrogenation with 10% Pd/C as catalyst. Alternatively, the aryloxyoxiranes can be converted to the ethanolamines by regioselective ring opening of the oxirane with dibenzylamine, followed by hydrogenation with 10% Pd/C as catalyst. ##STR10##

The arylethanolamines used in Scheme 1 can be prepared according to the methods shown in Scheme 9. Arylmethylketones are converted to the corresponding .alpha.-haloketones using known methods [J. March, Advanced Organic Chemistry, 3rd Ed., John Wiley and Sons, New York;1985, p529 and references cited therein]. The haloketones are reduced to the corresponding alcohol which can be protected as the triethylsilyl ether, or converted directly to the ethanolamine by treatment with ammonia or sodium azide followed by reduction. Treatment of the halo silyl ether with benzylamine followed by desilylation and hydrogenation also gives the corresponding arylethanolamine. ##STR11##

The compounds of this invention are useful in treating metabolic disorders related to insulin resistance or hyperglycemia, typically associated with obesity or glucose intolerance. The compounds of this invention are therefore, particularly useful in the treatment or inhibition of type II diabetes. The compounds of this invention are also useful in modulating glucose levels in disorders such as type I diabetes.

The ability of compounds of this invention to treat or inhibit disorders related to insulin resistance or hyperglycemia was established with representative compounds of this invention in the following standard pharmacological test procedures, which measured the binding selectivity to the .beta..sub.1, .beta..sub.2, and .beta..sub.3 adrenergic receptors. Binding to the receptors was measured in Chinese Hamster ovary (CHO) cells that were transfected with adrenergic receptors. The following briefly summarizes the procedures used and results obtained.

Transfection of CHO Cells with .beta..sub.1 and .beta..sub.2 Adrenergic Receptors:

CHO cells were transfected with human .beta..sub.1 - or .beta..sub.2 -adrenergic receptors as described in Tate, K. M., Eur. J. Biochem., 196:357-361(1991).

Cloning of Human .beta..sub.3 -AR Genomic DNA:

cDNA was constructed by ligating four polymerase chain reaction (PCR) products using the following primers: an ATG-Narl fragment, sense primer 5'-CTTCCCTACCGCCCCACGCGCGATC3' and anti-sense primer 5'CTGGCGCCCAACGGCCAGTGGCCAGTC3'; a Narl-Accl fragment, 5'TTGGCGCTGATGGCCACTGGCCGTTTG3' as sense and 5'GCGCGTAGACGAAGAGCATCACGAG3' as anti-sense primer; an Accli-Styl fragment, sense primer 5'CTCGTGATGCTCTTCGTCTCACGCGC3' and anti-sense primer 5'GTGAAGGTGCCCATGATGAGACCCAAGG3' and a Styl-TAG fragment, with sense primer 5'CCCTGTGCACCTTGGGTCTCATCATGG3' and anti-sense primer 5'CCTCTGCCCCGGTTACCTACCC3'. The corresponding primer sequences are described in Mantzoros, C. S., et. al., Diabetes 45: 909-914 (1996). The four fragments are ligated into a pUC 18 plasmid (Gibco-BRL) and sequenced. Full length .beta..sub.3 AR clones (402 amino acids) containing the last 6 amino acids of h.beta..sub.3-- AR are prepared with the .beta..sub.3 -.beta.ARpcDNA3 from ATTC.

Binding Procedure:

Clones expressing receptor levels of 70 to 110 fmoles/mg protein were used in the test procedures. CHO cells were grown in 24-well tissue culture plates in Dulbecco's Modified Eagle Media with 10% fetal bovine serum, MEM non-essential amino acids, Penicillin-Streptompycin and Geneticin. On the day of test procedure, growth medium was replaced with preincubation media (Dulbecco's Modified Eagle Media and incubated for 30 minutes at 37.degree. C. Preincubation medium was replaced with 0.2 ml treatment medium containing DMEM media containing 250 .mu.M IBMX (isobutyl-1-methylxantine) plus 1 mM ascorbic acid with test compound dissolved in DMSO. Test compounds were tested over a concentration range of 10.sup.-9 M to 10.sup.-5 M for .beta..sub.3 cells and 10.sup.-8 to 10.sup.-4 M for 1 and .beta..sub.2 transfected cells. Isoproterenol (10.sup.-5 M) was used as an internal standard for comparison of activity. Cells were incubated at 37.degree. C. on a rocker for 30 min with the .beta..sup.3 cells and 15 min for .beta..sub.1 and .beta..sub.2 cells. Incubation was stopped with the addition of 0.2N HCl and neutralized with 2.5N NaOH. The plates, containing the cells and neutralized media, were stored at -20 degrees celsius until ready to test for cAMP using the SPA test kit (Amersham).

Data Analysis and Results:

Data collected from the SPA test procedure were analyzed as percent of the maximal isoproterenol response at 10.sup.- 5 M. Activity curves were plotted using the SAS statistical and graphics software. EC.sub.50 values were generated for each compound and the maximal response (IA) developed for each compound is compared to the maximal response of isoproternol at 10.sup.-5 M from the following formula: ##EQU1##

Table I shows the EC.sub.50 and IA values for the representative compounds of this invention that were evaluated in this standard pharmacological test procedure that measured binding selectivity at that p-adrenergic receptors.

TABLE I beta-3 beta-2 beta-1 Example EC.sub.50 .mu.M (IA) EC.sub.50 .mu.M (IA) EC.sub.50 .mu.M (IA) 1 0.017 (0.92) (0) (0.09) 2 0.094 (1.1) (0.03) (0.16) 3 0.015 (1.1) 0.31 (0.59) 2.1 (0.66) 4 0.021 (0.78) (0) (0.17) 5 0.016 (0.98) (0.07) 2.2 (0.59) 6 0.2 (0.76) 7 0.02 (0.8) (0.01) 0.6 (0.15) 8 0.016 (0.91) 0.61 (0.28) 3.6 (0.41) 10 0.1 (0.45) 11 0.33 (0.83) 12 0.01 (1) 13 0.05 (0.7) 14 0.001 (1.3) 0.17 (0.53) 0.64 (1) 15 0.001 (1) 0.16 (0.37) 13 (0.23) 16 0.003 (0.86) 17 0.028 (0.81) 18 0.041 (0.99) 1 (0.55) (0.29) 19 0.007 (1) (0.2) 0.79 (0.54) 20 0.01 (1) 10 (0.3) 10 (0.4) 21 0.001 (1) 0.64 (0.82) 0.06 (0.88) 22 0.002 (1) 0.04 (0.63) 0.2 (1.08) 23 0.016 (1) 1.67 (0.89) 1.32 (0.68) 24 0.033 (0.88) 1 (0.68) 1 (0.35) 25 0.052 (1) 1.43 (0.37) 1 (0.63) 26 0.023 (0.98) 0.27 (0.29) 0.24 (0.41) 27 0.002 (1) 0.54 (0.29) 0.42 (0.22) 28 0.002 (0.94) 6.6 (0.85) (0.24) 29 0.007 (1.3) 2.9 (0.48) 2.0 (0.57) 30 0.004 (1.2) 3.6 (0.36) 9.8 (1.1) 31 0.007 (1.2) 12 (0.33) 20 (0.96) 32 0.004 (1) 10 (0.57) 6.7 (0.48) 33 0.018 (1) (0.15) 25 (0.66) 34 0.006 (1.1) (0.14) 10 (0.49) 35 0.011 (1.1) (0.04) 49 (0.66) 36 0.009 (1) 0.72 (0.19) 4.8 (0.85) 37 0.016 (0.89) 0.9 (0.42) 5.6 (0.43) 38 0.032 (1.1) 0.38 (0.32) 1.1 (0.5) 39 0.03 (1) (0.23) 10 (0.42) 40 0.004 (1.2) 0.04 (0.31) 1.9 (0.45) 41 0.002 (1) 2 (0.24) 0.8 (0.58) 42 0.001 (1) 0.37 (0.35) 1.32 (0.69) 43 0.001 (1) 0.09 (0.68) 1.28 (0.58) 44 0.003 (0.95) 2 (0.43) 12 (0.71) 45 0.001 (1) 0.7 (0.63) 0.02 (0.74) 46 0.009 (1.1) 47 0.006 (0.93) 3.2 (0.46) 1 (0.47) 48 0.59 (1) 10 (0.54) 10 (0.26) 49 0.009 (0.96) 50 0.01 (1) 7 (0.35) 2.6 (0.72) 52 0.006 (1) 0.48 (0.65) 0.96 (0.48) 53 0.034 (1.2) (0.23) (0.24) 54 0.014 (1.2) 12 (0.42) 2.3 (0.33) 55 0.41 (0.94) 56 0.014 (1) 1.6 (0.27) 9.5 (0.31) 57 0.006 (0.85) (0.18) (0.18) 58 0.011 (1) 3.9 (0.31) 3.6 (0.65) 59 0.015 (0.98) 12 (0.2) 7.8 (0.52) 60 0.021 (1.1) 10 (0.21) 10 (0.18) 61 0.001 (1.1) (0.2) 1.9 (0.3) 62 0.009 (1) 5 (0.31) 5 (0.32) 63 0.005 (0.91) (0.15) 10 (0.88) 64 0.004 (1.1) 5.9 (0.22) (0.11) 65 0.16 (0.93) 16 (0.67) (0.23) 66 0.025 (0.95) (0.17) 2.7 (0.44) 67 0.005 (0.96) (0.17) 1 (0.48)

Based on the results obtained in these standard pharmacological test procedures, representative compounds of this invention have been shown to be selective .beta..sub.3 adrenergic receptor agonists and are therefore useful in treating metabolic disorders related to insulin resistance or hyperglycemia, typically associated with obesity or glucose intolerance. More particularly, the compounds of this invention useful in the treatment or inhibition of type II diabetes, and in modulating glucose levels in disorders such as type I diabetes. As used herein, the term modulating means maintaining glucose levels within clinically normal ranges.

As used in accordance with this invention, the term providing an effective amount means either directly administering such a compound of this invention, or administering a prodrug, derivative, or analog which will form an effective amount of the compound of this invention within the body.

It is understood that the effective dosage of the active compounds of this invention may vary depending upon the particular compound utilized, the mode of administration, the condition, and severity thereof, of the condition being treated, as well as the various physical factors related to the individual being treated. For treating treating metabolic disorders related to insulin resistance or hyperglycemia generally satisfactory results may be obtained when the compounds of this invention are administered to the individual in need at a daily dosage of from about 0.1 mg to about 1 mg per kilogram of body weight, preferably administered in divided doses two to six times per day, or in a sustained release form. For most large mammals, the total daily dosage is from about 3.5 mg to about 140 mg. It is preferred that the administration of one or more of the compounds herein begin at a low dose and be increased until the desired effects are achieved.

Such doses may be administered in any manner useful in directing the active compounds herein to the recipient's bloodstream, including orally, via implants, parenterally (including intravenous, intraperitoneal and subcutaneous injections), rectally, intranasally, vaginally, and transdermally. For the purposes of this disclosure, transdermal administrations are understood to include all administrations across the surface of the body and the inner linings of bodily passages including epithelial and mucosal tissues. Such administrations may be carried out using the present compounds, or pharmaceutically acceptable salts thereof, in lotions, creams, foams, patches, suspensions, solutions, and suppositories (rectal and vaginal).

Oral formulations containing the active compounds of this invention may comprise any conventionally used oral forms, including tablets, capsules, buccal forms, troches, lozenges and oral liquids, suspensions or solutions. Capsules may contain mixtures of the active compound(s) with inert fillers and/or diluents such as the pharmaceutically acceptable starches (e.g. corn, potato or tapioca starch), sugars, artificial sweetening agents, powdered celluloses, such as crystalline and microcrystalline celluloses, flours, gelatins, gums, etc. Useful tablet formulations may be made by conventional compression, wet granulation or dry granulation methods and utilize pharmaceutically acceptable diluents, binding agents, lubricants, disintegrants, suspending or stabilizing agents, including, but not limited to, magnesium stearate, stearic acid, talc, sodium lauryl sulfate, microcrystalline cellulose, carboxymethylcellulose calcium, polyvinylpyrrolidone, gelatin, alginic acid, acacia gum, xanthan gum, sodium citrate, complex silicates, calcium carbonate, glycine, dextrin, sucrose, sorbitol, dicalcium phosphate, calcium sulfate, lactose, kaolin, mannitol, sodium chloride, talc, dry starches and powdered sugar. Oral formulations herein may utilize standard delay or time release formulations to alter the absorption of the active compound(s).

In some cases it may be desirable to administer the compounds directly to the airways in the form of an aerosol.

The compounds of this invention may also be administered parenterally or intraperitoneally. Solutions or suspensions of these active compounds as a free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxy-propylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparation contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.

Suppository formulations may be made from traditional materials, including cocoa butter, with or without the addition of waxes to alter the suppository's melting point, and glycerin. Water soluble suppository bases, such as polyethylene glycols of various molecular weights, may also be used.

The compounds of the present invention also possess utility for increasing lean meat deposition and/or improving lean meat to fat ratio in edible animals, i.e. ungulate animals and poultry.

Animal feed compositions effective for increasing lean meat deposition and for improving lean meat to fat ratio in poultry, swine, sheep, goats, and cattle are generally prepared by mixing the compounds of the present invention with a sufficient amount of animal feed to provide from about 1 to 1000 ppm of the compound in the feed. Animal feed supplements can be prepared by admixing about 75% to 95% by weight of a compound of the present invention with about 5% to about 25% by weight of a suitable carrier or diluent. Carriers suitable for use to make up the feed supplement compositions include the following: alfalfa meal, soybean meal, cottonseed oil meal, linseed oil meal, sodium chloride, cornmeal, cane molasses, urea, bone meal, corncob meal and the like. The carrier promotes a uniform distribution of the active ingredients in the finished feed into which the supplement is blended. It thus performs an important function by ensuring proper distribution of the active ingredient throughout the feed. The supplement is used as a top dressing for the feed, it likewise helps to ensure uniformity of distribution of the active material across the top of the dressed feed.

The preferred medicated swine, cattle, sheep and goat feed generally contain from 0.01 to 400 grams of active ingredient per ton of feed, the optimum amount for these animals usually being about 50 to 300 grams per ton of feed. The preferred poultry and domestic pet feed usually contain about 0.01 to 400 grams and preferably 10 to 400 grams of active ingredient per ton of feed.

For parenteral administration the compounds of the present invention may be prepared in the form of a paste or a pellet and administered as an implant, usually under the skin of the head or ear of the animal in which increase in lean meat deposition and improvement in lean mean to fat ratio is sought. In general, parenteral administration involves injection of a sufficient amount of the compounds of the present invention to provide the animal with 0.001 to 100 mg/kg/day of body weight of the active ingredient. The preferred dosage for swine, cattle, sheep and goats is in the range of from 0.001 to 50 mg/kg/day of body weight of active ingredient; whereas, the preferred dose level for poultry and domestic pets is usually in the range of from 0.001 to 35 mg/kg/day of body weight.

Paste formulations can be prepared by dispersing the active compounds in a pharmaceutically acceptable oil such as peanut oil, sesame oil, corn oil or the like. Pellets containing an effective amount of the compounds of the present invention can be prepared by admixing the compounds of the present invention with a diluent such as carbowax, carnuba wax, and the like, and a lubricant, such as magnesium or calcium stearate, can be added to improve the pelleting process. It is, of course, recognized that more than one pellet may be administered to an animal to achieve the desired dose level which will provide the increase in lean meat deposition and improvement in lean meat to fat ratio desired. Moreover, it has been found that implants may also be made periodically during the animal treatment period in order to maintain the proper drug level in the animal's body. For the poultry and swine raisers, using the method of the present invention yields leaner animals.

Additionally, the compounds of this invention are useful in increasing the lean mass to fat ratio in domestic pets, for the pet owner or veterinarian who wishes to increase leanness and trim unwanted fat from pet animals, the present invention provides the means by which this can be accomplished.

The following procedures describ