System for production of helper dependent adenovirus vectors based on use of endonucleases Number:7,135,187 from the United States Patent and Trademark Office (PTO) owispatent The present invention relates to methods for efficient and reliable construction of adenovirus vectors which contain and express foreign DNA and are useful for gene transfer into mammalian cells, for vaccines and for gene therapy. The invention provides for the growth and purification of adenovirus vectors (helper dependent vectors or HDVs) from which all or most of the viral genes have been removed. The vector system described herein is a new method designed to eliminate helper viruses from the final HDV preparation by cleavage of the helper virus DNA with an endonuclease, alone or in combination with other methods known to limit the level of helper virus contamination of helper dependent vector preparations. The disclosed methods and compositions also provide for regulated control of gene expression.<H endonucleases, adenovirus, System, for, prod, 7135187.html, Patent, pto, 7135187

Title: System for production of helper dependent adenovirus vectors based on use of endonucleases

Abstract: The present invention relates to methods for efficient and reliable construction of adenovirus vectors which contain and express foreign DNA and are useful for gene transfer into mammalian cells, for vaccines and for gene therapy. The invention provides for the growth and purification of adenovirus vectors (helper dependent vectors or HDVs) from which all or most of the viral genes have been removed. The vector system described herein is a new method designed to eliminate helper viruses from the final HDV preparation by cleavage of the helper virus DNA with an endonuclease, alone or in combination with other methods known to limit the level of helper virus contamination of helper dependent vector preparations. The disclosed methods and compositions also provide for regulated control of gene expression.

Patent Number: 7,135,187 Issued on 11/14/2006 to Graham, et al.

Inventors: Graham; Frank L. (Rome, IT), Ng; Philip (Pearland, TX), Parks; Robin (Ottawa, CA)
Assignee: AdVec, Inc. (Ancaster, CA)

Appl. No.: 10/355,330

Filed: January 31, 2003

Related U.S. Patent Documents


Application Number	Filing Date	Patent Number	Issue Date
09883649	Jun., 2001
09475813	Dec., 1999
09250929	Feb., 1999
08473168	Jun., 1995	5919676
08250885	May., 1994	6140087
08080727	Jun., 1993

Current U.S. Class: 424/233.1 ; 435/235.1; 435/320.1; 536/23.72

Current International Class: A61K 39/23 (20060101); C07H 21/04 (20060101); C12N 15/00 (20060101); C12N 7/00 (20060101)

References Cited [Referenced By]

U.S. Patent Documents


4510245	April 1985	Cousens et al.
4797368	January 1989	Carter et al.
4920209	April 1990	Davis et al.
4920211	April 1990	Tibbetts et al.
5474896	December 1995	Dujon et al.
5670488	September 1997	Gregory et al.
5849553	December 1998	Anderson et al.
5882877	March 1999	Gregory et al.
5919676	July 1999	Graham et al.
5998205	December 1999	Hallenbeck et al.
6001557	December 1999	Wilson et al.
6080569	June 2000	Graham et al.
6261807	July 2001	Crouzet et al.

Foreign Patent Documents


0 919 624	Jun., 1999	EP
WO 93/06223	Apr., 1993	WO
WO 93/19092	Sep., 1993	WO
WO 93/19191	Sep., 1993	WO
WO 94/08026	Apr., 1994	WO
WO94/12649	Jun., 1994	WO
WO95/27071	Dec., 1995	WO
WO 96/13597	May., 1996	WO
WO 96/13598	May., 1996	WO
WO 96/14408	May., 1996	WO
WO 96/40955	Dec., 1996	WO
WO 97/05255	Feb., 1997	WO
WO 97/32481	Sep., 1997	WO
WO 98/13510	Apr., 1998	WO
WO 99/02647	Feb., 1999	WO
WO 99/41400	Aug., 1999	WO
WO 99/53085	Oct., 1999	WO
WO 99/61638	Dec., 1999	WO

Other References

Anglana, Mauro and Silvia Bacciietti, "Construction of a Recombinant Adenovirus for Efficient Delivery of the I-Seel Yeast Endonuclease to Human Cells and it's Application in the In Vivo Cleavage of Chromosomes to Expose New Potential Telomeres," Nucleic Acids Research (1999) 27 (21) 4276-4181. cited by other .
Anton, M., and F. L. Graham, 1995, Site-specific recombination mediated by an adenovirus vector expressing the Cre recombinase protein: a molecular switch for control of gene expression, J. Virol. 69: 4600-4606. cited by other .
Araki, K., J. Araki, J. I. Miyazaki, and P. Vassali, 1995, Site-specific recombination of a transgene in fertilized eggs by transient expression of Cre recombinase. Proc. Nat'l. Acad. Sci. USA 92: 160-164. cited by oth- er .
Bett, A. J., L. Prevec, and F. L. Graham, 1993, Packaging capacity and stability of human adenovirus type 5 vectors. J. Virol. 67: 5911-5921. cited by other .
Bett, A. J., W. Haddara, L. Prev, and F. L. Graham, 1994, An efficient and flexible system for construction of adenivorus vectors with insertions or deletions in early region 1 and 3. Proc. Nat'l. Acad. Sci. USA 91:8802-8806. cited by other .
D'Halluin et al., "Restriction maps of human adenovirus types 2, 5 and 3 for Bell, Clal. Pvul and Sphl", Gene, 21(1-2):165-169, 1983. cited by oth- er .
DiSanto, J.P., W. Mueller, D. Guy-Grand, A. Fischer, and K. Rajewsky, 1995, Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor chain, Proc. Nat'l. Acad. Sci. USA 92: 377-381. cited by other .
Gage, P.J., B. Sauer, M. Levin and J. C. Glorioso. 1992. A cell-free recombination system for site-specific integration of multigenic shuttle plasmids into the herpes simplex virus type 1 genome. J. Virol. 66: 5509-5515. cited by other .
Genbank Accession No. M73260, 1996. cited by other .
Graham, F. L. and L. Prevec. 1991. Manipulation of adenovirus vectors. In Murray E.J. (ed.), Methods in Molecular Biology. The Humana Press Inc. Clifton, N.J. vol. 7 (Gene Transfer Expression Protocols): 109-128. cited by other .
Graham F. L. and L. Prevec. 1992. Adenovirus-based expression vectors and recombinant vaccines. in: Vaccines; New Approaches in Immunological Problems., ed. Ellis, R.W. Butterworth-Heinemann, Boston, MA: 363-390. cited by other .
Graham F. L., J. Smiley, W. C. Russel and R. Naim. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5., J. Gen. Virol. 36: 59-72. cited by other .
Gu, H., J. D. Marth, P.C. Orban, H. Mossmann and K. Rajewsky. 1994. Deletion of a DNA polymerase B gene segment in T cells using cell type-specific gene targeting. Science 265: 103-106. cited by other .
Haj-Ahmad and Graham, "Characterization of an adenovirus type 5 mutant carrying embedded inverted terminal repeats," Virology, 153:22-34, 1986. cited by other .
Kangegae Y., et al., "Efficient Gene Activation in Mammalian Cells by Using Recombinant Adenovirus Expressing Site-Specific CRE Recombinase," Nucleic Acids Research (1995) 23 (19) 3816-3821. cited by other .
Kilby, N. J., M. R. Snaith, and J. A. H. Murray. 1993. Site-specific recombinases: tools for genome engineering. Trends Genet. 9: 413-421. cit- ed by other .
Metzger, D., J. Clifford, H. Chiba and P. Chambon. 1995. Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre protein. Proc. Nat'l. Acad. Sci. USA 92: 6991-6995. cited by other .
Pichel, J.G., Lakso, and H. Westphal. 1993. Timing of SV40 oncogene activation by site-specific recombination determines subsequent tumor progression during murine lens development. Oncogene 8: 3333-3342. cited by other .
Sauer, B. 1994. Site-specific recombination: developments and applications. Cur. Opin. Biotech. 5: 521-527. cited by other .
Sauer, Brian and Nancy Henderson. 1988. Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc. Nat'l. Acad. Sci. USA 85: 5166-5170nn. cited by other .
Sauer, B., and N. Henderson. 1990. Targeted insertion of exogenous DNA into the eukaryotic genome by the Cre recombinase. The New Biologist 2: 441-449. cited by other .
Sauer, B., M. Whealy, A. Robbins and L. Enquist. 1987. Site-specific insertion of DNA into a pseudorabies virus vector. Proc. Nat'l. Adac. Sci. USA 84: 9108-9112. cited by other .
Smith A. J. H., M. A. DeSousa, B. Kwabi-Addo, A. Heppel-Parton, H. Impey, and P. Rabbits. 1995. A site-directed chromosomal translocation induced in embryonic stem cells by Cre-loxP recombination. Nature Genetics 9: 376-385. cited by other .
Sternberg, N., B. Sauer, R. Hoess, and K. Abremski. 1986. Bacteriophase P1 cre gene and its regulatory region; Evidence for multiple promotors and for regulation by DNA methylation., J. Mol. Biol. 187: 197-212. cited by other .
Van Deursen, J., M. Fornerod, B. Van Rees, and G. Grosveld. 1995. Cre-mediated site specific translocation between non-homologous mouse chromosomes. Proc. Nat'l. Acad. Sci. USA 92: 7376-7380. cited by other .
Mittal, S.K., McDermott, M.R., Johnson, D.C., Prevec, L. and F. L. Graham. 1993. Monitoring foreign gene expression by a human adenovirus-based vector using the firefly luciferase gene as a reporter, Virus Research, 28: 67-90. cited by other .
Hanke, T., Frank L. Graham, Kenneth L. Rosenthal and David C. Johnson. 1991. Identification of an immunodomimant cytotoxic t-lymphocyte recognition site in glycoprotein B of herpes simplex virus by using recombinant adenovirus vectors and synthetic peptides. 1991. J. of Virology, 65: 1177-1186. cited by other .
Hearing, Patrick and Shenk, Thomas, 1983, "The Adenovirus Type 5 B1A Transcriptional Control Region Contains A Duplicated Enhancer Element." Cell:33 695-703. cited by other .
Graham, F.L., 1987. Growth of 293 cells in suspension culture. J. Gen. Virol. 68: 937-940. cited by other .
Meganuclease 1-Sec I (Omega-Nuclease) Boehringer Mannheim Catalog (2 pages). cited by other .
Nicolas, Andrea et al., "Creation and Repair of Specific DNA Double-Strand Breaks In Vivo Following Infection with Adenovirus Vectors Expressing Saccharomyces Cerevisiae HO Endonuclease," Virology (2000) 266 (1): 211-224. cited by other .
Quantin, B., Leslie D. Pericaudet, Shahragim Tajbakhsh and Jean-Louis Mandel. 1992. Adenovirus as an expression vector in muscle cells in vivo. Proc. Nat'l. Acad. Scie. 89: 2581-2584. cited by other .
Rosenfeld, M.A. et al., 1992. In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium, Cell. 68: 143-155. cited by other .
W. J. McGrory, D. S. Baulista and F. L. Graham. 1998. A simple technique for the resue of early region 1 mutations into infectious human adenovirus type 5, Virology 163: 614-617. cited by other .
Wang, P., Anton, F. L. Graham and S. Bacchetti. High Frequency recombination between loxP sites in human chromosomes mediated by an adeniovorus vector expressing Cre recombinase. Somat Cell Mol Genet. Nov. 1995; 21(6):429-41. cited by other .
Russ, Andreas P., et al., 1996,. Self-deleting Retrovirus Vectors for Gene Terapy, J. of Virology, pp. 4927-4932. cited by other .
Xiao, Weidong et al., A Novel system to generate helper free gutless vectors. Abstract No. 133, p. 44, 1999 Keystone Symposium on Molecular and Cellular Biology of Gene Therapy. cited by other .
Gudrun Schiedner, et al., 1998. Genomic DNA transfer with a high-capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nature Genetics 18: 180-183. cited by other .
Manal A. Morsy, et al., 1998. An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Nat'l. Acad. Sci. USA 95: 7866-7871. cited by oth- er .
Stephen Hardy, et al., 1997. Construction of Adenovirus Vectors through Cre-lox Recombination. Jour. Virol. 71: 3 1842-1849. cited by other .
Parks, et al., 1996. A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Pro. Nat'l. Acad. Sci. USA 93: 13565-13470. cited by other.

Primary Examiner: Schnizer; Richard
Attorney, Agent or Firm: Fischer; Joseph Beusse, Wolter, Sanks, Mora & Maire, P.A.

Parent Case Text

CROSS REFERENCES TO RELATED APPLICATIONS

This application is a continuation of application Ser. No. 09/883,649, filed on Jun. 19, 2001, now abandoned, which is a continuation of application Ser. No. 09/475,813, filed on Dec. 30, 1999, abandoned, which is a continuation-in-part of application Ser. No. 09/250,929, filed on Feb. 18, 1999, abandoned, which was a continuation-in-part of application Ser. No. 08/473,168, filed Jun. 7, 1995, now U.S. Pat. No. 5,919,676, which was a continuation-in-part of application Ser. No. 08/250,885(now U.S. Pat. No. 6,140,187), filed on May 31, 1994, which was a continuation-in-part of application Ser. No. 08/080,727, filed on Jun. 24, 1993, abandoned. Priority of each of these applications is claimed herein, and the disclosure of each of these applications is hereby incorporated by reference.

Claims

What is claimed is:

1. A helper adenovirus nucleic acid sequence comprising a packaging signal, an inserted endonuclease recognition site, a first adenoviral inverted terminal repeat (ITR) located at one end of, and a second adenoviral ITR located at the other end of, the nucleic acid sequence, and a third adenoviral ITR located between the first and second adenoviral ITRs, wherein: (a) said endonuclease recognition site is for an endonuclease that does not cleave anywhere else in said helper adenovirus nucleic acid sequence, and wherein said endonuclease recognition site is disposed at a location in said helper adenovirus nucleic acid sequence 3' to said packaging signal; and (b) wherein said third adenoviral ITR is disposed at a location in said helper adenovirus nucleic acid sequence 3' to said endonuclease recognition site.

2. A helper adenovirus nucleic acid sequence comprising a packaging signal, an endonuclease recognition site, a first ITR located at one end of, and a second ITR located at the other end of, the nucleic acid sequence, and third ITR located between the first and second ITRs, wherein: (a) said endonuclease recognition site is for an endonuclease that does not cleave anywhere else in the helper adenovirus nucleic acid sequence, and wherein said endonuclease recognition site is disposed at a location in said helper adenovirus nucleic acid sequence 3' to said packaging signal; (b) said third ITR is disposed at a location in said adenovirus 3' to said endonuclease recognition site; and (c) said packaging signal is flanked on either side thereof by recognition sites for a recombinase, such that upon contact of said helper adenovirus nucleic acid sequence with said recombinase, said packaging signal is excised.

3. The helper adenovirus nucleic acid sequence according to claim 2 wherein said recognition site for a recombinase is a loxP site, and said recombinase is Cre, or wherein said recognition site for a recombinase is a FRT site, and said recombinase is FLP.

4. The helper adenovirus nucleic acid sequence according to claim 2 wherein said endonuclease recognition site is flanked on either side thereof by recognition sites for a recombinase, such that upon contact of said helper adenovirus nucleic acid sequence with said recombinase, said endonuclease recognition site is excised.

5. The helper adenovirus nucleic acid sequence according to claim 4 wherein said recognition sites for a recombinase are loxP sites, and said recombinase is Cre, or wherein said recognition sites for a recombinase are FRT sites, and said recombinase is FLP.

6. The adenovirus according to claim 2 wherein said packaging signal and said endonuclease recognition site are flanked by recognition sites for a recombinase, such that upon contact of said helper adenovirus nucleic acid sequence with said recombinase, said packaging signal and said endonuclease recognition site are excised.

7. The helper adenovirus nucleic acid sequence according to claim 6 wherein said recombinase recognition sites are loxP recognition sites, and said recombinase is Cre, or wherein said recognition sites for a recombinase are FRT sites, and said recombinase is FLP.

8. The helper adenovirus nucleic acid sequence according to claim 2 wherein said endonuclease recognition site is for the endonuclease Scel.

9. The helper adenovirus nucleic acid sequence according to claim 2 further comprising a deletion or modification in a nucleic acid sequence encoding an adenovirus pIX gene product, wherein the helper adenovirus nucleic acid sequence is not able to produce pIX proteins for its own packaging into an infectious adenoviral virion.

10. A system for producing a helper dependent adenovirus vector comprising: (a) a helper adenovirus nucleic acid sequence comprising a packaging signal, an inserted endonuclease recognition site, a first ITR located at one end of, and a second ITR located at the other end of, the nucleic acid sequence, and a third ITR located between the first and second ITRs, wherein: (i) said endonuclease recognition site is for an endonuclease that does not cleave anywhere else in the helper adenovirus genome, and wherein said endonuclease recognition she is disposed at a location in said helper adenovirus nucleic acid sequence 3' to said packaging signal; and (ii) said third ITR is disposed at a location in said helper adenovirus nucleic acid sequence 3' to said endonuclease recognition site; and (b) a helper dependent adenovirus vector comprising a left adenoviral ITR, a right adenoviral ITR, an adenoviral packaging signal and additional nucleic acid sequences, such that upon co-introduction of said helper dependent adenovirus vector into a cell with said helper adenovirus nucleic acid sequence, said helper dependent adenovirus vector is packaged.

11. The system according to claim 10 wherein said packaging signal of said helper adenovirus nucleic acid sequence is flanked on either side by a recombinase recognition site.

12. The system according to claim 11 wherein said recombinase recognition sites are loxP recognition sites, and said recombinase is Cre, or wherein said recognition site for a recombinase is a FRT site, and said recombinase is FLP.

13. The system according to claim 11 further comprising a cell which expresses said endonuclease which cleaves said endonuclease recognition site.

14. The system according to claim 12 further comprising a cell which expresses said Cre and said endonuclease which cleaves said endonuclease recognition site.

15. The system according to claim 11 further comprising a cell which expresses one or more adenoviral gene products encoded by adenoviral E1.

16. The system according to claim 11 wherein said helper adenovirus nucleic acid sequence comprises a deletion or mutation in a sequence encoding an adenovirus pIX gene product, rendering the nucleic acid sequence unable to produce the pIX gene product in a functional form, thereby inhibiting packaging adenoviral DNA larger than approximately 35 Kb.

17. The system according to claim 16 further comprising a cell which expresses said adenovirus pIX gene product.

18. A method for making a helper dependent adenovirus vector preparation which comprises: (A) making a helper adenovirus having a nucleic acid sequence comprising an endonuclease recognition site inserted 3' to an adenoviral packaging signal, a first ITR located at one end of, and a second ITR located at the other end of, the helper adenovirus nucleic acid sequence, and a third ITR located between the first and second ITRs and disposed 3' to said endonuclease recognition site; and (B) propagating said helper dependent adenovirus vector in the presence of said helper adenovirus of (A) in a cell permissive for replication of said helper dependent adenovirus vector, wherein during said propagating said helper adenovirus nucleic acid sequence is rendered incapable of being packaged into an infectious adenoviral virion due to deletion of the adenoviral packaging signal by endonuclease-mediated cleavage, alone or in combination with: (a) site-directed recombinatorial excision of said packaging signal: or (b) a deletion or mutation of adenoviral pIX encoding sequences, whereby a size restricted limitation of genome packaging prevents packaging of a genome which exceeds approximately 35 kb; or both (a) and (b).

19. The method according to claim 18 wherein said step for making said helper dependent adenovirus vector comprises co-introducing said helper dependent adenoviral vector and said helper adenovirus into a cell, wherein said cell expresses an endonuclease which induces endonuclease-mediated cleavage of the adenoviral packaging signal from said helper adenovirus.

20. The method according to claim 19 wherein said cell further expresses a recombinase which induces site-directed recombinatorial excision of said packaging signal.

21. The method according to claim 18 additionally comprising propagating said helper adenovirus, said helper adenovirus nucleic acid sequence comprising a deletion or mutation in a pIX encoding nucleic acid sequence rendering the helper adenovirus nucleic acid sequence unable to produce a functional pIX gene product, such that reduced functional pIX protein levels are produced by said helper adenovirus in cells expressing adenoviral pIX.

22. The method according to claim 18 further comprising co-introducing said helper dependent adenoviral vector and said helper virus into a cell which does not express adenoviral pIX.

Description

FIELD OF THE INVENTION

The invention is a new method of producing helper adenoviruses and helper-dependent adenovirus vectors (HDVs) in which helper virus is eliminated from HDV preparations by cleavage of the helper virus DNA with an endonuclease. The invention can be used independently of Cre/lox, or other helper virus containment systems, or in combination with Cre/lox, or other helper virus containment systems, to minimize the level of helper virus contamination of HDV preparations.

BACKGROUND OF THE INVENTION

In U.S. patent application Ser. No. 08/473,168, (the '168 application), published as WO96/40955, now U.S. Pat. No. 5,919,676, hereby incorporated by reference, a system for making helper-dependent adenovirus vectors and helper andenoviruses was disclosed. That system employed a recombinase, such as Cre, expressed by a cell into which a helper virus, comprising loxP sites flanking the adenovirus packaging signal, was introduced, (i.e. the packaging sequence was "floxed"). By virtue of the recombinase expressed by the host cell, the helper adenovirus packaging signal was excised, thereby restricting the packaging of the helper virus. Co-introduction of a helper-dependent, recombinant adenovirus vector (HDV) containing a packaging signal permitted isolation of efficiently packaged helper-dependent virus. However, as may be appreciated by those skilled in the art, any "leakage" of that system results in the contamination of helper-dependent adenovirus vector preparations with helper virus. The present invention is directed to methods and helper virus constructs, which result in production of HDV preparations wherein the level of packaged helper virus contamination is reduced by an endonuclease. The constructs and techniques taught herein may be employed independently from the Cre-loxP system described according to the WO96/40955 publication, or the techniques taught herein may be used to augment the effectiveness of that system.

Furthermore, those skilled in the art will appreciate, based on the disclosure provided herein, that a system such as that disclosed in parent application Ser. No. 08/719,217 (now U.S. Pat. No. 6,080,569), a foreign equivalent of which published as WO98/13510, hereby incorporated by reference, maybe augmented by the system disclosed and claimed herein. In the WO98/13510 system, a helper adenovirus was described wherein the pIX gene was deleted or disabled. In such a modified adenovirus, a genome greater than about 35 kb is not efficiently packaged, irrespective of the presence or absence of a functional packaging signal, .psi., unless the helper virus is propagated in a cell which complements the pIX deficiency. In combination with the present invention, a doubly or triply disabled helper virus is produced, if the Cre/loxP recombination system is also used, which is still capable of providing, in trans, all of the functions necessary to support replication of a helper-dependent adenovirus vector (HDV).

Those skilled in the art are familiar with endonucleases and the use of such compositions, whether expressed endogenously or introduced from an external source, in the cleavage of specific target sequences in a segment of nucleic acid.

Those skilled in the art will also appreciate that adenoviruses contain inverted terminal repeats (ITRs) at each end of the genome, which are essential to replication of adenoviruses. The ITRs (representing the most terminal approximately 100 200 bp of the viral genome) are the only Ad DNA sequences needed in cis for viral DNA replication, and the packaging signal (.psi.), which is needed for packaging of viral DNA into virion capsids, is the only additional cis acting sequence needed for production of virions. Thus, appropriate helper viruses may be used to provide, in trans, all other factors required for replication of the HDV. Furthermore, it is known that adenoviruses containing an ITR embedded within the genome are capable of replicating, through a repair process, even though an external ITR is eliminated (see, for example, Haj-Ahmad and Graham, Virology 153:22 34, 1986). What has not been previously demonstrated, however, is the application of this observation in the production of helper viruses and helper dependent virus preparations substantially free of helper virus contamination.

SUMMARY OF THE INVENTION

The present invention relates to methods for efficient and reliable construction of adenovirus vectors that contain and express foreign DNA and are useful for gene transfer into mammalian cells, for vaccines and for gene therapy. The invention provides for the growth and purification of adenovirus vectors (helper dependent vectors or HDVs) from which all or most of the viral genes have been removed. The vector system described herein is a new method designed to eliminate helper viruses from the final HDV preparation by cleavage of the helper virus DNA with an endonuclease.

Accordingly, it is one object of this invention to provide a simple and useful system whereby helper dependent adenovirus vectors may be propagated and purified and wherein contamination with helper virus is significantly reduced or eliminated.

Another object of this invention is to provide a method whereby reduction of helper adenovirus contamination of helper-dependent adenovirus vector preparations is achieved or augmented.

Another object of this invention is to provide a preparation of helper-dependent adenovirus vector substantially free of helper virus, such that the helper-dependent vector preparation is substantially free of virus capable of replicating in host cells into which the vector is introduced.

Another object of this invention is to provide methods and compositions of enhanced utility for vaccine and gene therapeutic applications.

Other objects of this invention will be apparent from a review of the complete disclosure and from the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a diagrammatic representation of a helper adenovirus containing an endonuclease recognition cleavage site (SceI) near the left end of the viral genome and positioned to the right of the adenovirus packaging signal, .psi., illustrating the effects of endonuclease cleavage and ITR repair.

FIG. 2 is a diagrammatic representation showing a method for propagation of a helper dependent Ad vector (HDV) from which all or most of the viral genes have been deleted and substituted with foreign DNA.

FIG. 3 illustrates a method for combining the Cre/lox system and the SceI system to produce a helper virus for improved production of helper free helper dependent vectors.

FIG. 4 illustrates the construction of a shuttle plasmid derived from p.DELTA.E1SP1A wherein an SceI recognition site is introduced adjacent to the packaging signal followed by insertion of an ITR sequence.

FIG. 4a illustrates the sequences of oligonucleotides used in various cloning procedures.

FIG. 5 illustrates the use of PCR to amplify adenovirus ITRs from the plasmid pAdHV1HelperpIX.sup.-.

FIG. 6 illustrates the construction of a shuttle plasmid derived from pLC8 wherein an SceI recognition site is introduced adjacent to the floxed packaging signal followed by insertion of an ITR sequence to the right of the second lox site.

FIG. 7 illustrates the structure of new helper viruses derived by cotransfection of 293 cells with pBHG101uc and the shuttle plasmids of FIGS. 4 and 6.

FIG. 8 shows a Southern blot hybridization analysis of cleavage products generated by coinfection of A549 cells with a virus containing an SceI site near the left end of the genome (AdNG15) and a second virus, AdMSceI, expressing the SceI endonuclease.

FIG. 9 illustrates construction of a plasmid expressing SceI and hygromycin resistance for transformation of cells.

FIG. 9a and 9b illustrate construction of a plasmid containing an EMCV IRES sequence for use in construction of the plasmid of FIG. 9.

FIG. 10 illustrates a method for combining the Cre/loxP system of copending patent application Ser. No. 08/473,168 (hereby incorporated by reference, entitled "Adenoviral Vector System Comprising Cre-LoxP Recombination"), published as WO96/40955, the pIX system of copending patent application Ser. No. 08/719,217 (now U.S. Pat. No. 6,080,569), (hereby incorporated by reference, entitled "Improved Adenovirus Vectors Generated from Helper Viruses and Helper Dependent Vectors"), published as WO98/13510, and the endonuclease system of the present invention, for production of a helper dependent vector substantially free of helper virus.

FIG. 11. Correction and optimization of the I-SceI gene. The plasmid pMH4SceI (a gift from M. Anglana and S. Bacchetti) was constructed by cloning the 853 bp EcoRI/SalI fragment containing the I-SceI gene from a plasmid containing the Sce I gene, pCMV-I-SceI (Rouet P, Smith F, Jasin M Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells. Proc Natl Acad Sci USA Jun. 21, 1994;91(13):6064 6068), into the EcoRI/SalI sites of pMH4 (available from Microbix Biosystems).) Sequence analysis (A) showed that the I-SceI gene in pMH4SceI contained a single base pair deletion (nine A's between nt 173 and 181 instead of ten) in the nuclear localization signal (see inset for sequence ladder, SEQ ID NO: 9 and SEQ ID NO: 10 for nucleic acids and SEQ ID NO:11 and SEQ ID NO:12 for peptide sequence) resulting in premature termination of translation at an immediately downstream TAG. The position of the Kozak consensus sequence relative to the start codon for I-SceI was also not optimal. Therefore, the sequence of the 5' end of the I-SceI coding sequence was corrected and optimized (new sequence shown in (B). This modification was accomplished using synthetic oligonucleotides AB16751 and AB16752 (respectively, SEQ ID NO:13 and SEQ ID NO: 14 for the nucleic acids and SEQ ID NO: 15 and SEQ ID NO: 16 for the peptide sequences) as described in FIG. 12A.

FIG. 12. Construction of a plasmid for generation of cell lines stably expressing I-SceI. (A) An oligonucleotide (AB16751: 5' AATTCGCCGCCGCCATGGGATCATCATCAGACG ACGAAGCAACAGCAGACGCACAACACGCAGCACCACCAAAAAAAAAACGAAAAGTAG AAGACCCACGATTTATGTACCCATACGATGTTCCTGACTATGCGGG 3' (SEQ ID NO:17)+AB1675:5'TACCCGCATAGTCAGGAACATCGTATGGGTACATAAATCGTGGGTCTTCTACT TTTCGTTTTTTTTTTGGTGGTGCTGCGTGTTGTGCGTCTGCTGTTGCTTCGTCGTCTGATG ATGATCCCATGGCGGCGGCG 3' (SEQ ID NO:18) bearing a Kozak consensus sequence, a nuclear localization signal (nls) and an influenza hemagglutinin (HA) epitope was inserted into the EcoRI and NdeI sites of phCMV-1 I-SceI (Choulika et al., 1995 MCB 15:1968) replacing the hCMV promotor to generate pknlsHA-SceI. The 849 bp EcoRI/SalI fragment from pknlsHA-SceI was inserted into the EcoRI/SalI sites of pMH4 (Addison et al., 1997) to generatepNG24. The 269 bp EcoRI fragment from pMH4(I), bearing an intron (Mathews et al., 1999), was inserted into the EcoRI site of pNG24 to generate pNG24i. The virus AdNGUS24i was generated by in vivo homologous recombination between pNG24i and pJM17 following their cotransfection into 293 cells. (B) The 980 bp PacI/BstEII fragment from pNG24i was cloned into the PacI and BstEII sites of pNG19 to generate pNG26i. Cell lines stably expressing I-SceI were generated by transfection of 293Cre4 cells with pNG26i.

FIG. 13. Development of cell lines expressing I-SceI. 100 mm dishes of semiconfluent monolayers of 293Cre4 cells (Chen, L., Anton, M. and Graham, F. L. Production and characterization of human 293 cell lines expressing the site-specific recombinase Cre. Somat. Cell and Molec. Genet. 22: 477 488, 1996.) were transfected with 5 .mu.g of pNG26i (FIG. 12B) by calcium phosphate coprecipitation (Graham, F. L. and van der Eb., A. J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456 467, 1973.). Three days post-transfection, hygromycin was added to the culture media at concentrations of 200, 400, 600 or 800 .mu.g/ml. Following selection, individual hygromycin resistant colonies were isolated, expanded and analyzed for I-SceI expression by Southern (FIG. 14) and Western blot hybridization (FIG. 15).

FIG. 14. Analysis of I-SceI activity in 293Cre4 cells transformed with pNG26i. 35 mm dishes of the indicated transformed cell line were infected with AdNGUS201TR2 (described in FIG. 21) at an moi of 1. 48 hrs post-infection, viral DNA was extracted and subjected to Southern blot hybridization with probe fragment B following digestion with Bst11071. In the presence of I-SceI cleavage, the 4.4 kb Bst11071 fragment of AdNGUS20ITR2 is expected to be converted to a 2.4 kb Bst11071 fragment.

FIG. 15. I-SceI expression in 293Cre4 cells transformed with pNG26i determined by Western blot analysis. The Western shows I-SceI protein (31 kDa) in 293 cells 24 hrs after infection with AdNGUS24i at an moi of 5 for (lane 1) or in various 293Cre4 cells stably transformed with pNG26i (lanes 3 to 14). Lane 2 contains 293Cre4 cell extract as a negative control. Total protein was extracted by incubating cells with Radioimmunoprecipitation assay buffer for 30' on ice. Samples were centrifuged and total protein of the supernatant was determined using a quantitative colormetric assay (Micro BCA assay reagent kit, Pierce). 2.5 .mu.g of protein was fractionated on a 10% SDS-polyacrylamide gel and transferred to Immobilon P polyvinylidene difluoride membrane (Millipore) using a Transblot cell (Bio-Rad). The HA-tagged I-SceI protein is expected to be .about.30.7 kDa and was detected using Anti-HA high affinity Rat monoclonal antibody [clone 3F10; 100 ng/ml in PBS-buffered skim milk (5%); Roche] and a peroxidase conjugated affinipure Donkey Anti-Rat IgG (H+L) [160 ng/ml in PBS-buffered skim milk (5%); Jackson Immuno Research Laboratories]. Chemiluminescence using an ECL Western Blotting Detection Kit (Amersham) and XAR5 film (Eastman Kodak Company) was used to monitor the peroxidase reaction. Molecular weights (kDa, Rainbow Marker; Amersham) are shown to the right. The band in lane 1 between 66 kDa and 97.4 kDa is specific to adenovirus infected cells and may represent a viral protein that binds to one of the Abs used in the hybridization.

FIG. 16. Modifications to the ends of Ad DNA by panhandle formation and various repair modes. An intermediate step in adenoviral DNA replication occurs though pairing of the terminal ITRs of single stranded DNA to generate a panhandle structure. For viruses bearing an internal ITR as depicted in (A), two possible ITR pairings may occur: pairing between the two terminal ITRs or pairing of the internal ITR with the rightmost ITR. In the former case, DNA replication will result in a progeny molecule that is identical to the parental DNA. In the latter case, two possible progenies, both different from the parental molecule may result: one bearing four ITRs and one bearing two ITRs. The molecule bearing two ITRs (B) can replicate but cannot be packaged into virions owing to the loss of the packaging signal (.psi.) thus representing an ideal helper genome. If the viral DNA bears a Sce-I site between the leftmost ITR and the internal ITR, as depicted in (A), then this species can also be generated by I-SceI cleavage followed by panhandle formation and repair. In contrast, the species bearing four ITRs (C) can replicate as well as be packaged. This species can undergo further rearrangements through panhandle formation of any two ITRs during replication to generate a plethora of different species. Propagation of these variants is limited only by their size.

FIG. 17. Left end structures after duplication of DNA segments by panhandle formation. The left end of AdNG20ITR is present on a 2.8 kb Bst1107I fragment. Cleavage by I-SceI followed by repair using the internal ITR results in a 2.4 kb fragment. In the absence of I-SceI cleavage, the genome of AdNG20ITR may undergo rearrangements mediated by the internal ITR as depicted in FIG. 16. These rearrangements can extend the left end of the genome by multiples of 428 bp resulting in Bst1107I fragments of 3.2 kb, 3.7 kb, etc. Similarly, the right end of the genome can also be extended (not shown).

FIG. 18. Strategy to block propagation of rearranged viruses bearing an internal ITR. A simple strategy to block propagation of rearranged virus due to the presence of the internal ITR is to render the rearranged products too large to be packageable. To this end, a stuffer segment can be introduced into the viral genome between the leftmost and internal ITR as depicted. While this modification will not prevent rearrangement, it will prevent the rearranged products from being propagated since the genomes of these viral variants will exceed the upper packaging limit.

FIG. 19. Strategy to block propagation of rearranged viruses bearing an internal ITR. As in FIG. 18 except for the presence of loxP sites in the viral genome as depicted.

FIG. 20. Effectiveness of stuffer in eliminating propagation of internal ITR-mediated rearranged genomes. 35 mm dishes of 293 cells were infected with the indicated virus at an moi of 1. At 48 hrs post-infection, viral DNA was extracted and analyzed by Southern blot hybridization with probe fragment B following digestion with Bst1107I. As shown, a 2.8 kb Bst1107I fragment (black triangle in lane 2) is expected from the unrearranged genome of AdNG20ITR depicted in FIG. 17. However, additional bands at higher molecular sizes (white triangles in lane 2) are also observed. These correspond to the internal ITR-mediated rearrangement products depicted in FIG. 17. The intensity of these bands suggests that the rearranged species can propagate and may be expected to contribute to further rearrangements. Lane 3 shows the results of similar analysis for a second helper virus, AdNG15ITR indicating that formation of variant viruses is a general phenomenon for viruses with internal ITRs. Propagation of such rearranged viruses is virtually eliminated by inclusion of a stuffer segment as in the case of AdNGUS20ITR2 (lane 4) as only the expected 4.4 kb Bst1107I fragment from the parental virus is observed. Similarly, propagation of the rearrangement products of AdNG15ITR was observed (white triangles in lane 3), but virtually eliminated by inclusion of a stuffer as shown for AdNGUS14-1 in lanes 5 and 6.

FIG. 21. Helper viruses with one or two SceI recognition sites. The helper viruses AdNGUS20ITR2, AdNGUS41 and AdNGUS43 are identical except for the number and position of the I-SceI recognition site(s). Essential features common to these viruses include an internal ITR to permit viral DNA replication of I-SceI cleaved helper genome DNA and a 1560 bp fragment of bacteriophage .lamda. DNA inserted between the two left end ITRs to prevent packaging of rearranged viral genomes that are generated by panhandle formation using the internal ITR during DNA replication. AdNGUS20ITR2 contains a single SceI site located between the .lamda. DNA stuffer and the packaging signal (.psi.). AdNGUS41 contains two SceI sites flanking .psi. and the .lamda. DNA. AdNGUS43 contains a single SceI site located between the leftmost ITR and the .lamda. DNA stuffer.

FIG. 22. Construction of shuttle plasmids for rescue of helper viruses bearing sites. (A) An oligonucleotide bearing the I-SceI recognition sequence (SEQ. ID. NO.:1, AB14265+SEQ. ID. NO.:2, AB14270, SEQ ID NO: 19 and SEQ ID NO: 20) was inserted into the SwaI sites of pLC8 (Parks et al., 1996) replacing the neomycin phosphotransferase gene to generate pNG14. The 168 bp XbaI fragment bearing the SceI and loxP sites from pNG14 was cloned into the XbaI site of pGEM7(f+) (Promega) to generate pGEM7-NG14b. An ITR was PCR amplified from pAdHV1pIX-(gift from Andy Bett) with primers AB15051 (5' GGATATCTGCAGATCTACTCCGCCCTAAAAC 3', SEQ ID NO: 5) and AB15052 (5'CCTCGAGTCGACGCGAGATCGAATTC 3', SEQ ID NO: 6). The PCR product was disgested with PstI and HincII and the 168 bp fragment was cloned into the PstI and HincII sites of pGEM7-NG14b to generate pGEM7-NG14bITR. (B) The plasmid pGEM7-NG14bITR was digested with XhoI and ClaI, Klenow end modified and self ligated to generate pGEM7-NG14bITR.DELTA. which bears a unique BstBI site. The 1560 bp BsaHI fragment from lambda DNA was inserted into the BstBI site of pGEM7-NG14bITR.DELTA. to generate pGEM7-NGUS14bITR1. The loxP site was removed from pGEM7-NGUS14bITR1 by BamHI digestion followed by ligation to generate pNG29. The SceI site was removed from pNG29 by AvaI and AflII digestion, Klenow end modification, followed by self ligation to generate pNG42. (C) The plasmid pNG27-2 was generated by inserting an oligonucleotide bearing the SceI site (SEQ. ID. NO.:1, AB14265+SEQ. ID. NO.:2, AB14270) into the BamHI site of pLC4. The plasmid pNG41 was generated by inserting the 1818 bp XbaI fragment from pNG29 into the XbaI site of pNG27-2. pNG41 was used to generate the helper virus AdNGUS41 by in vivo homologous recombination following cotransfection into 293 cells with pUMA71 (Parks et al., 1996).The plasmid pNG43 was generated by inserting the 1773 bp XbaI fragment from pNG42 into the XbaI site of pNG27-2. pNG43 was used to generate the helper virus AdNGUS43 by in vivo homologous recombination following cotransfection into 293 cells with pUMA71. (D) The plasmid pNG15ITR was constructed by replacing the 168 bp XbaI fragment in pNG15 with the 312 bp XbaI fragment from pGEM7-NG15bITR. The plasmid pNG15 was constructed in the same way as pNG14 (see FIG. 22A) and differs from pNG14 only in the orientation of the SceI oligo. The plasmid pGEM7-NG15bITR was constructed in the same way as pGEM7-NG14bITR (see FIG. 22A) and differs from pGEM7-NG14bITR only in the orientation of the SceI oligo. The helper virus AdNG15ITR (FIG. 19) was generated by in vivo homologous recombination between pNG15ITR and pUMA71 following their cotransfection into 293 cells. The plasmid pNGUS 14-1 was constructed by replacing the 312 bp XbaI fragment in pNG15ITR with the 1872 bp XbaI fragment from pGEM7-NGUS14bITR1 (FIG. 22B). The helper virus AdNGUS14-1 (FIG. 19) was generated by in vivo homologous recombination between pNGUS14-1 and pUMA71 following their cotransfection into 293 cells.

FIG. 23. Construction of the shuttle plasmid for rescue of helper viruses bearing an I-SceI site. An oligonucleotide bearing the SceI site (SEQ. ID. NO.:1, AB14265+SEQ. ID. NO.:2, AB14270) was inserted into the EcoRV site of p.DELTA.E1SP1A to generate pNG20. An ITR was PCR amplified from pAdHV1pIX--with primers AB15051 and AB15052. The PCR product was digested with SalI and EcoRI and the 165 bp fragment was cloned into the SalI and EcoRI sites of pNG20 to generate pNG20ITR. The 1560 bp BsaHI fragment from lambda DNA was inserted into the ClaI site of pNG20ITR to generate pNGUS20ITR2. The helper virus AdNGUS20ITR2 was generated by in vivo homologous recombination between pNGUS20ITR2 and pUMA71 following their cotransfection into 293 cells.

FIG. 24. Southern analysis of viral DNA extracted from 293SceI cells infected with various helper viruses illustrating the efficiency of I-SceI cleavage in vivo and generation of variant viral DNA molecules. Cultures of the indicated cell lines (the parental 293Cre4 cell line and the I-SceI expressing 293Cre4 derivatives, 2 16 and 4 7) in 35 mm dishes were infected with the various helper viruses bearing SceI recognition sites as illustrated in FIG. 21 at an moi of 1. At 48 hrs post-infection, viral DNA was extracted and analyzed by Southern blot hybridization with probe fragment B (see FIG. 21) following digestion with Bst1107I . For the viruses AdNGUS20ITR2, AdNGUS41 and AdNGUS43, Bst1107I cleavage is expected to generate fragments with molecular weights 4.4 kb, 4.5 kb and 4.4 kb, respectively, in the absence of I-SceI cleavage (FIG. 21). Following I-SceI cleavage, these fragments are all expected to be converted to a 2.4 kb Bst1107I fragment (indicated by the black triangles) as a result of panhandle repair using the internal ITR during DNA replication. However, in the case of AdNGUS41 and AdNGUS43, but not AdNGUS20ITR2, an unexpected band of .about.8.4 to 8.6 kb (indicated by the white circles) is present following infection of I-SceI expressing cells. One feature common to both AdNGUS41 and AdNGUS43, but not AdNGUS20ITR2, is the presence of an SceI site to the left of .psi.. As illustrated in FIGS. 26 and 27, this feature may account for the presence of the novel .about.8.4 to 8.6 kb band. Furthermore, in the case of AdNGUS41, an unexpected band of .about.2.7 kb is also present (indicated by the white triangle). A possible mechanism responsible for the presence of this band is presented in FIG. 26.

FIG. 25. Illustration of in vivo I-SceI cleavage and rearrangement of AdNGUS20ITR helper virus genome following infection of 293Cre cells expressing SceI. I-SceI cleavage of AdNGUS20ITR2 renders the genome unpackagable due to the removal of .psi.. The resulting genome can still replicate, and hence provide helper functions, by panhandle formation using the internal ITR. This process results in a viral genome that, following Bst1107I digestion and Southern blot hybridization, produces the fragment indicated by the black triangle in FIG. 12. It can be seen that cleavage by I-SceI and use of an internal ITR to generate a replicating viral DNA is highly efficient as there is relatively little of the parental 4.4 kb band remaining.

FIG. 26. Illustration of in vivo I-SceI cleavage and rearrangement of AdNGUS41 helper virus genome following infection of 293Cre cells expressing I-SceI. I-SceI cleavage of AdNGUS41 results in three fragments. Panhandle repair using the internal ITR allows the genome to replicate and provide helper functions but the resulting genome is unable to be packaged due to the absence of .psi. (right part of Figure). Bst1107I digestion results in a 2.4 kb fragment (black triangle in FIG. 24). The unexpected 2.7 kb band shown in lanes 5 and 6 of FIG. 24 (indicated by the white triangles) can arise as a consequence of the joining of fragments A and C following I-SceI cleavage. An SceI site is unlikely to be recreated by this joining due to the incompatibility of the two half-sites, rendering this species resistant to recleavage by I-SceI which may account for the relatively high intensity of the 2.7 kb band. The unexpected .about.8.6 kb band seen in FIG. 24 (indicated by the white circles in lanes 5 and 6) can be generated by the joining of fragments B and C of one genome to the same fragments of another genome. The relatively high intensity of this band suggests that it does not contain any SceI sites. Because repair of double strand breaks, which this process exemplifies, frequently results in loss of a few nucleotides, loss of the SceI sites is not unexpected. The resulting DNA molecule indicated at the bottom of the Figure, can replicate and thus provide helper functions, but, while it retains .psi., it is not expected to be packageable due to the distance of .psi. from the genome terminus. I-SceI cleavage and fragment rejoining is surprisingly efficient as can be seen from the intensities of the various bands on the Southern blot. It can be seen that there is almost no parental, unprocessed viral DNA in lanes 5 and 6 (no band at 4.4 4.5 kb), indicating that packageable parental viral genomes have been virtually 100% eliminated. Thus a helper virus with a packaging signal flanked by SceI sites and optionally with an internal ITR may be a preferred embodiment.

FIG. 27. Illustration of in vivo I-SceI cleavage and rearrangement of AdNGUS43 helper virus genome following infection of 293Cre cells expressing I-SceI. I-SceI cleavage of AdNGUS43 renders it noninfectious due to its inability to replicate in the absence of a terminal left end ITR. Viral DNA replication, but not packaging, can be restored following panhandle formation using the internal ITR. The unexpected band of .about.8.4 kb shown in FIG. 24 (indicated by the white circles in lanes 8 and 9) can be generated by joining of fragment B of one cleaved genome with the same fragment from another cleaved genome. This species likely lacks an SceI site. The viral DNA molecule generated by head to head joining can replicate but, as with the similar species illustrated in FIG. 26, is unable to package because only packaging signals located near the ends of viral DNA molecules are functional.

FIG. 28. Illustration of I-SceI cleavage and double strand break repair to regulate gene expression from a molecular switch in an Ad vector. An Ad vector can be readily constructed wherein a cDNA is separated from a promoter by a spacer DNA that blocks expression of the cassette and wherein the spacer DNA is flanked by SceI sites. I-SceI mediated cleavage and joining of the left and right fragments of the viral DNA as illustrated effectively results in excision of the spacer and a switch on of expression, of .beta.-galactosidase in the example shown here.

FIG. 29. Illustration of control of gene expression in cells of a transgenic animal by an I-SceI dependent molecular switch. Expression cassettes can be readily engineered in cells or in transgenic animals such that gene expression from said cassettes can be regulated by I-SceI mediate DNA cleavage and subsequent double strand break repair. Such "molecular switches" can be designed such that gene expression is switched on or switched off depending on the placement of the I-SceI recognition sites. For example an expression cassette can be introduced into cells or animals such that expression of a protein encoding, for example, .beta.-galactosidase, is blocked by positioning a spacer DNA between a promoter and the coding sequences for said protein. I-SceI mediated excision and subsequent double strand break repair results in excision of the spacer and a switch on of expression. Alternatively, the cDNA encoding, for example .beta.-galactosidase, could be flanked by SceI sites so that SceI mediated DNA cleavage and double strand break repair results in a switch off of expression. Not meant to be limiting as there are many ways to introduce SceI sites into cellular DNA such that SceI mediated cleavage and DNA fragment rejoining will result in rearrangements of DNA that regulate gene expression. For example endogenous genes such as those encoding oncogenes, tumor suppressor genes, genes encoding various proteins such as cytokines, enzymes and the like may be regulated by the methods described herein.

FIG. 30. Use of SceI cleavage and double strand break repair or Cre-lox mediated excision for production of helper dependent vectors in a pIX based system. In this example pIX coding sequences of a helper virus are flanked by either SceI sites or lox sites such that upon infection of cells expressing I-SceI or Cre recombinase, respectively, the pIX gene is excised resulting in abolition of pIX expression. A consequence is that the packaging capacity of the resulting virions (lacking pIX) is diminished so that the helper virus genome is unable to package into virions. In contrast, the helper dependent vector genome is designed to be sufficiently small that it is readily packaged in pIX-virions resulting in virus preparations enriched for the helper dependent vector.

FIG. 31. Amplification kinetics of the helper dependent vector AdRP1050. Amplification of AdRP1050 using the indicated combination of cell line and helper virus was performed as described (Parks et al., 1996). Bfu, blue forming units; T, transfection; P1, passage 1; P2, passage 2; P3 passage 3; P4, passage 4.

FIG. 32. AdMSceI-encoded I-SceI can efficiently cleave an intrachromosomal recognition site in vivo in replication-permissive cells. Genomic DNA, extracted from AdMSceI-infected 293.1 cells, Addl70-3-infected cells or mock-infected cells at 22 hours after infection were digested with HindIII and analysed by Southern hybridization with a neo probe. (A) Structure of integrated mMA2. Solid bars represent plasmid DNA with the region detected by the neo probe in black. Thin lines represent chromosomal sequences and arrows indicate the telomeric array in its orientation. The products of cleavage with HindIII (H) and I-SceI (S) (2 kb) or (H) alone (3 kb) are shown. (B) MOI and molecular weights (in kb) are indicated. The cleavage activity in percent cleaved molecules is shown below each lane. Mock- refers to DNA from mock-infected cells digested with (H), while mock+ refers to the same DNA digested with (H) and commercial I-SceI.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Any publications referenced herein are hereby incorporated by reference in this application in order to more fully describe the state of the art to which the present invention pertains.

It is important to an understanding of the present invention to note that all technical and scientific terms used herein, unless otherwise defined, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. The techniques employed herein are also those that are known to one of ordinary skill in the art, unless stated otherwise.

Reference to particular buffers, media, reagents, cells, culture conditions and the like, or to some subclass of same, is not intended to be limiting, but should be read to include all such related materials that one of ordinary skill in the art would recognize as being of interest or value in the particular context in which that discussion is presented. For example, it is often possible to substitute one buffer system or culture medium for another, such that a different but known way is used to achieve the same goals as those to which the use of a suggested method, material or composition is directed.

The terms used herein are not intended to be limiting of the invention. For example, the term "gene" includes cDNAs, RNA, or other polynucleotides that encode gene products. "Foreign gene" denotes a gene that has been obtained from an organism or cell type other than the organism or cell type in which it is expressed; it also refers to a gene from the same organism that has been translocated from its normal situs in the genome. In using the terms "nucleic acid", "RNA", "DNA", etc., we do not mean to limit the chemical structures that can be used in particular steps. For example, it is well known to those skilled in the art that RNA can generally be substituted for DNA, and as such, the use of the term "DNA" should be read to include this substitution. In addition, it is known that a variety of nucleic acid analogues and derivatives are also within the scope of the present invention. "Expression" of a gene or nucleic acid encompasses not only cellular gene expression, but also the transcription and translation of nucleic acid(s) in cloning systems and in any other context. The term "recombinase" encompasses enzymes that induce, mediate or facilitate recombination, and other nucleic acid modifying enzymes that cause, mediate or facilitate the rearrangement of a nucleic acid sequence, or the excision or insertion of a first nucleic acid sequence from or into a second nucleic acid sequence. The "target site" of a recombinase is the nucleic acid sequence or region that is recognized (e.g., specifically binds to) and/or acted upon (excised, cut or induced to recombine) by the recombinase. The term "gene product" refers primarily to proteins and polypeptides encoded by other nucleic acids (e.g., non-coding and regulatory RNAs such as tRNA, sRNPs). The term "regulation of expression" refers to events or molecules that increase or decrease the synthesis, degradation, availability or activity of a given gene product.

The present invention is also not limited to the use of the cell types and cell lines use