Senior Fitness - Exercise and Nutrition for Aging Men and Women
FREE Article Feed for your website.
Bio-Medical Research Article Database
Informative Articles on Life, Love and Happiness
Tutorials on Business to Writing
Famous Quotes from Famous People
Song Lyric Information
New US Patent Information
Comprehensive List of Content by Category
Online Auctions and Shopping Related Articles
Article Search
Most Recent Articles

Use of VEGF inhibitors for treatment of eye disorders Number:7,521,049 from the United States Patent and Trademark Office (PTO) owispatent

Home    Author Login    Submit Article    Article Search    Add Your Link    Edit Your Link    Contact Us    Advertising    Disclaimer

   

Google
 

Top Breaking News
     Maldives Issues Arrest Warrant for Former Leader by VOA News
     Rights Group Criticizes Russia, China for Supplying Sudan with Weapons by VOA News
     Wave of Violence Continues in Syrian Flashpoint City by VOA News

Title: Use of VEGF inhibitors for treatment of eye disorders

Abstract: Modified chimeric polypeptides with improved pharmacokinetics and improved tissue penetration are disclosed useful for treating eye disorders, including age-related macular degeneration and diabetic retinopathy.

Patent Number: 7,521,049 Issued on 04/21/2009 to Wiegand,   et al.


Inventors: Wiegand; Stanley J. (Croton-on-Hudson, NY), Papadopoulos; Nicholas J. (LaGrangeville, NY), Yancopoulos; George D. (Yorktown Heights, NY), Fandl; James P. (LaGrangeville, NY), Daly; Thomas J. (New City, NY)
Assignee: Regeneron Pharmaceuticals, Inc. (Tarrytown, NY)
Appl. No.: 11/998,709
Filed: November 30, 2007


Related U.S. Patent Documents

Application NumberFiling DatePatent NumberIssue Date
11218234Dec., 20077303747
11089803Dec., 20077306799
10988243Dec., 20077303746
10009852Jul., 20067070959
PCT/US00/14142May., 2000
10880021Oct., 20077279159
10609775Aug., 20067087411
60138133Jun., 1999

Current U.S. Class: 424/134.1 ; 424/192.1; 514/12; 514/2; 530/350; 536/23.4
Current International Class: A61K 38/18 (20060101); C07K 14/71 (20060101); C12N 15/62 (20060101)


References Cited [Referenced By]

U.S. Patent Documents
6100071 August 2000 Davis-Smyth et al.
6897294 May 2005 Davis-Smyth et al.
2005/0281831 December 2005 Davis-Smyth et al.
Foreign Patent Documents
WO97/44453 Nov., 1997 WO
WO98/13071 Apr., 1998 WO
WO99/03996 Jan., 1999 WO

Other References

Terman, B.I., et al., (1991) Oncogene 6:1677-1683. cited by other .
Terman, B.I., et al., (1992) Biochem. Biophys. Res. Comm. 187(3):1579-1586. cited by other .
Davis-Smyth, T., et al., (1996) The EMBO Journal 15(18):4919-4927. cited by other .
Holash, J., et al., (2002) PNAS 99(17):11393-11398. cited by other .
Heidaran, M.A., et al., (1990) J. Bio. Chem. 265(31):18741-18744. cited by other .
Cunningham, S.A., et al., (1997) Biochem. Biophys. Res. Comm. 231:596-599. cited by other .
Fuh, G., et al., (1998) J. Bio. Chem. 273(18):11197-11204. cited by other .
Wiesmann, C., et al., (1997) Cell 91:695-704. cited by other .
Barleon, B., et al., (1997) J. Bio. Chem. 272(16):10382-10388. cited by other .
Davis-Smyth, T., et al., (1998) J. Bio. Chem. 273(6):3216-3222. cited by other.

Primary Examiner: Saoud; Christine J.
Assistant Examiner: Lockard; Jon M
Attorney, Agent or Firm: Gregg, Esq.; Valeta

Parent Case Text



CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional of U.S. patent application Ser. No. 11/218,234 filed 1 Sep. 2005, now U.S. Pat. No. 7,303,747, which is a continuation-in-part of application Ser. No. 11/089,803 filed 25 Mar. 2005, now U.S. Pat. No. 7,306,799, which is a continuation-in-part of application Ser. No. 10/988,243 filed 12 Nov. 2004, now U.S. Pat. No. 7,303,746, which is a continuation-in-part of application Ser. No. 10/009,852 filed 6 Dec. 2001, now U.S. Pat. No. 7,070,959, which is the National Stage of International Application No. PCT/US00/14142 filed 23 May 2000, which claims the benefit under 35 USC .sctn. 119(e) of U.S. Provisional 60/138,133 filed 8 Jun. 1999, and U.S. patent application Ser. No. 11/218,234 filed 1 Sep. 2005, now U.S. Pat. No. 7,303,747 is a continuation-in-part of application Ser. No. 10/880,021 filed 29 Jun. 2004, now U.S. Pat. No. 7,279,159, which is a continuation-in-part of application Ser. No. 10/609,775 filed 30 Jun. 2003, now U.S. Pat. No. 7,087,411, which applications are herein specifically incorporated by reference in their entireties.
Claims



We claim:

1. A therapeutic method for treating or ameliorating an eye disorder, comprising administering a fusion polypeptide capable of binding vascular endothelial growth factor (VEGF) to a patient in need thereof, wherein the fusion polypeptide consists essentially of an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor Flt1 and Ig domain 3 of a second VEGF receptor Flk1 or Flt4; and a multimerizing component, wherein the multimerizing component is an amino acid sequence between 1 and 200 amino acids in length having at least one cysteine residue.

2. The therapeutic method of claim 1, wherein the Ig domain 2 and Ig domain 3 are the only VEGF receptor components of the fusion polypeptide.

3. The therapeutic method of claim 2, wherein the fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 23.

4. The therapeutic method of claim 1, wherein the eye disorder is age-related macular degeneration or diabetic retinopathy.

5. The therapeutic method of claim 4, wherein the eye disorder is associated with choroidal neovascularization, vascular leak, and/or retinal edema.

6. A therapeutic method for treating or ameliorating an eye disorder, comprising administering a fusion polypeptide capable of binding vascular endothelial growth factor (VEGF) to a patient in need thereof, wherein the fusion polypeptide consists essentially of an immunoglobulin-like (Ig) domain 2 of Flt1 and Ig domain 3 of Flk1 or Flt4, and a multimerizing component, wherein the fusion polypeptide comprises the amino acid sequence of SEQ ID NO:23.

7. The therapeutic method of claim 6, wherein the eye disorder is age-related macular degeneration or diabetic retinopathy.

8. The therapeutic method of claim 6, wherein administration is selected from one of eye drops, subconjunctival injection, subconjunctival implant, intravitreal injection, intravitreal implant, sub-Tenon's injection, and sub-Tenon's implant.

9. A method for the treatment of a human subject diagnosed with age-related macular degeneration, comprising administering an effective amount of a vascular endothelial growth factor (VEGF) fusion polypeptide to the human subject, wherein the fusion polypeptide consists essentially of an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor Flt1 and Ig domain 3 of a second VEGF receptor Flk1 or Flt4; and a multimerizing component having between 1 and 200 amino acids in length having at least one cysteine residue, the method comprising: (a) administering to the subject an initial dose of at least approximately 25-4000 ug VEGF inhibitor protein per eye; and (b) administering to the subject a plurality of subsequent doses of the VEGF fusion polypeptide in an amount that is approximately the same or less than the initial dose, wherein the subsequent doses are separated in time from each other by at least two weeks.

10. The method of claim 9, wherein the initial dose is at least approximately 50 ug of VEGF fusion polypeptide.

11. The method of claim 10, wherein the initial dose is at least approximately 100 ug of VEGF fusion polypeptide.

12. The method of claim 11, wherein the initial dose is at least approximately 1000 ug of VEGF fusion polypeptide.

13. The method of claim 12, wherein the subsequent doses are separated in time from each other by at least four weeks.

14. The method of claim 13, wherein the subsequent doses are separated in time from each other by at least 3 to 6 months.

15. The method of claim 9, wherein the initial dose and at least one subsequent dose is administered by intravitreal injection.
Description



BACKGROUND

Statement Regarding Related Art

A class of cell-derived dimeric mitogens with selectivity for vascular endothelial cells has been identified and designated vascular endothelial cell growth factor (VEGF). VEGF is a dimer with an apparent molecular mass of about 46 kDa with each subunit having an apparent molecular mass of about 23 kDa. The membrane-bound tyrosine kinase receptor, known as Flt (also known as VEGFR2), was shown to be a VEGF receptor (DeVries et al. (1992) Science 255:989-991). Another form of the VEGF receptor, designated KDR or Flk-1 (also known as VEGFR3), is also known to bind VEGF and induce mitogenesis (Terman et al. (1991) Oncogene 6:1677-1683; Terman et al. (1992) Biochem. Biophys. Res. Comm. 187:1579-1586).

U.S. Pat. No. 6,011,003 describes an altered, soluble form of Flt polypeptide capable of binding to VEGF comprising five or fewer complete immunoglobulin domains. WO 97/44453 describes chimeric VEGF receptor proteins comprising amino acid sequences derived from VEGF receptors Flt1 and KDR.

BRIEF SUMMARY OF THE INVENTION

The invention features a therapeutic method for treating or ameliorating an eye disorder, comprising administering a vascular endothelial growth factor (VEGF) inhibitor to a patient in need thereof. In one embodiment, the eye disorder treated is age related macular degeneration. In another embodiment, the eye disorder treated is diabetic retinopathy.

Preferably, the VEGF inhibitor used in the method of the invention comprises an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor and Ig domain 3 of a second VEGF receptor; and a multimerizing component, wherein the first VEGF receptor is Flt1, the second VEGF receptor is Flk1 or Flt4, and the multimerizing component is selected from the group consisting of (i) an amino acid sequence between 1 to about 200 amino acids in length having at least one cysteine residue, and (ii) an immunoglobulin domain, or fragment of an immunoglobulin domain. In specific embodiments, the VEGF inhibitor is a fusion polypeptide "VEGF trap" selected from the group consisting of SEQ ID NO:2 (Flt1D2.Flk1D3Fc.DELTA.C1(a)), SEQ ID NO:4 (Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)), SEQ ID NO:6 (VEGFR1R2 Fc.DELTA.C1(a)), and SEQ ID NO:23. In another embodiment, the VEGF inhibitor is a fusion polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO:1, 3, 5, 22, and a nucleotide sequence which, as a result of the degeneracy of the genetic code, differs from the nucleotide sequence of SEQ ID NO:1, 3, 5, and 22.

In a second aspect, the invention features a method for the treatment of a human subject diagnosed with an eye disorder, comprising administering an effective amount of a vascular endothelial growth factor (VEGF) inhibitor to the human subject, the method comprising administering to the subject an initial dose of at least approximately 25-4000 ug VEGF inhibitor protein to an affected eye, and administering to the subject a plurality of subsequent doses of the VEGF inhibitor protein in an amount that is approximately the same or less than the initial dose, wherein the subsequent doses are separated in time from each other by at least two weeks. The eye disorder is one of age-related macular degeneration or diabetic retinopathy. In various embodiments, the initial dose is at least approximately 25 to 4000 ug of VEGF inhibitor protein. In various embodiments, the subsequent doses are separated in time from each other by at least two weeks to 12 months; more preferably, the subsequent doses are separated in time from each other by at least 3-6 months. The VEGF inhibitor protein is administered directly to the affected eye, including by use of eye drops or intravitreal injection. Preferably, the VEGF inhibitor is a dimer having two fusion polypeptides consisting essentially of an immunoglobulin-like (Ig) domain 2 of Flt1 and Ig domain 3 of Flk1 or Flt4, and a multimerizing component. In specific embodiments, the VEGF inhibitor is a dimer comprising the fusion polypeptide of SEQ ID NO:2, 4, 6, or 23.

Other objects and advantages will become apparent from a review of the ensuing detailed description.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Biacore analysis of binding stoichiometry. Binding stoichiometry was calculated as a molar ratio of bound VEGF165 to the immobilized Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a), using the conversion factor of 1000 RU equivalent to 1 ng/ml.

FIG. 2. Pharmacokinetics of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a).

FIG. 3. Pharmacokinetics of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).

FIG. 4. VEGFR1R2-Fc.DELTA.C1(a) prevents neovascularization induced by retinal ischemia. Serial 10 .mu.m cross sections were collected and stained with hematoxylin and eosin. For each animal, nuclei in preretinal neovessels were counted in a series of ten sections within 300 microns of the optic nerve head and averaged. Counts were obtained in three independent experiments, n.gtoreq.4 for each treatment group in each study.

FIG. 5. Effect of subcutaneous VEGFR1R2-Fc.DELTA.C1(a) injections on choroidal neovascularization area. The size of CNV lesions was measured in choroidal flat mounts. The images were digitized using an Axioskop microscope equipped with a video camera, and the total area of choroidal neovascularization associated with each laser burn was measured using Image-Pro Plus software.

FIG. 6. VEGFR1R2-Fc.DELTA.C1(a) inhibits subretinal neovascularization in Rho/VEGF transgenic mice.

FIGS. 7A-B. VEGF-Induced breakdown of the blood retinal barrier. A. Following intravitreal injections of VEGF, adult mice (C57BL/6) treated with injections of VEGFR1R2-Fc.DELTA.C1(a) had a significantly smaller retina to lung leakage ratio than mice treated with Fc fragment, indicating less breakdown of BRB. B. Double transgenic mice treated with injections of VEGFR1R2-Fc.DELTA.C1(a) had a significant reduction in the retina to lung leakage ratio compared to mice treated with Fc fragment.

FIG. 8. Effect of VEGFR1R2-Fc.DELTA.C1(a) administration on corneal thickness in suture and alkali burn models of corneal trauma. Corneas were injured by suture placement or application of NaOH as described, and a single dose of VEGFR1R2-Fc.DELTA.C1(a) (25 mg/kg, ip) or saline (n=5 per group) was administered immediately following injury. The contralateral cornea served as normal, undamaged controls. Corneas were collected 7 days later and cross-sections were cut and stained with hematoxylin and eosin. Corneal thickness was measured as an index of corneal edema.

FIG. 9. System or intravitreal VEGF trap protein administration prevents laser-induced choroidal neovascularization (CNV) and reverses vascular leak in established lesions.

FIG. 10. Dose response curve of Baf/Flt cells grown in VEGF.

FIG. 11. Inhibition of VEGF growth response by VEGF trap VEGFR1R2-Fc.DELTA.C1(a) or anti-VEGF antibody.

DETAILED DESCRIPTION OF THE INVENTION

It has been a longstanding problem in the art to produce a receptor-based VEGF antagonist that has a pharmacokinetic profile that is appropriate for consideration of the antagonist as a therapeutic candidate. Applicants describe herein, for the first time, a chimeric polypeptide molecule, capable of antagonizing VEGF activity, that exhibits improved pharmacokinetic properties as compared to other known receptor-based VEGF antagonists. The chimeric polypeptide molecules described herein thus provide appropriate molecules for use in therapies in which antagonism of VEGF is a desired result.

The extracellular ligand binding domain is defined as the portion of a receptor that, in its native conformation in the cell membrane, is oriented extracellularly where it can contact with its cognate ligand. The extracellular ligand binding domain does not include the hydrophobic amino acids associated with the receptor's transmembrane domain or any amino acids associated with the receptor's intracellular domain. Generally, the intracellular or cytoplasmic domain of a receptor is usually composed of positively charged or polar amino acids (i.e. lysine, arginine, histidine, glutamic acid, aspartic acid). The preceding 15-30, predominantly hydrophobic or apolar amino acids (i.e. leucine, valine, isoleucine, and phenylalanine) comprise the transmembrane domain. The extracellular domain comprises the amino acids that precede the hydrophobic transmembrane stretch of amino acids. Usually the transmembrane domain is flanked by positively charged or polar amino acids such as lysine or arginine. von Heijne has published detailed rules that are commonly referred to by skilled artisans when determining which amino acids of a given receptor belong to the extracellular, transmembrane, or intracellular domains (See, von Heijne (1995) BioEssays 17:25.

Nucleic Acid Constructs and Encoded Fusion Polypeptides

The present invention provides for the construction of nucleic acid molecules encoding chimeric polypeptide molecules that are inserted into a vector that is able to express the chimeric polypeptide molecules when introduced into an appropriate host cell. Appropriate host cells include, but are not limited to, bacterial cells, yeast cells, insect cells, and mammalian cells. Any of the methods known to one skilled in the art for the insertion of DNA fragments into a vector may be used to construct expression vectors encoding the chimeric polypeptide molecules under control of transcriptional/translational control signals. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinations (See Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory; Current Protocols in Molecular Biology, Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, N.Y.).

Expression of nucleic acid molecules encoding the chimeric polypeptide molecules may be regulated by a second nucleic acid sequence so that the chimeric polypeptide molecule is expressed in a host transformed with the recombinant DNA molecule. For example, expression of the chimeric polypeptide molecules described herein may be controlled by any promoter/enhancer element known in the art.

Thus, according to the invention, expression vectors capable of being replicated in a bacterial or eukaryotic host comprising chimeric polypeptide molecule-encoding nucleic acids as described herein, are used to transfect the host and thereby direct expression of such nucleic acids to produce the chimeric polypeptide molecules, which may then be recovered in a biologically active form. As used herein, a biologically active form includes a form capable of binding to VEGF. Expression vectors containing the chimeric nucleic acid molecules described herein can be identified by three general approaches: (a) DNA-DNA hybridization, (b) presence or absence of "marker" gene functions, and (c) expression of inserted sequences. In the first approach, the presence of a foreign gene inserted in an expression vector can be detected by DNA-DNA hybridization using probes comprising sequences that are homologous to the inserted chimeric polypeptide molecule sequences. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. For example, if the chimeric polypeptide molecule DNA sequence is inserted within the marker gene sequence of the vector, recombinants containing the insert can be identified by the absence of the marker gene function. In the third approach, recombinant expression vectors can be identified by assaying the foreign gene product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the chimeric polypeptide molecules.

Cells of the present invention may transiently or, preferably, constitutively and permanently express the chimeric polypeptide molecules.

The chimeric polypeptide molecules may be purified by any technique which allows for the subsequent formation of a stable, biologically active chimeric polypeptide molecule. For example, and not by way of limitation, the factors may be recovered from cells either as soluble proteins or as inclusion bodies, from which they may be extracted quantitatively by 8M guanidinium hydrochloride and dialysis (see, for example, U.S. Pat. No. 5,663,304). In order to further purify the factors, conventional ion exchange chromatography, hydrophobic interaction chromatography, reverse phase chromatography or gel filtration may be used.

The method of the invention encompasses the use of a fusion protein consisting essentially of first and second vascular endothelial growth factor (VEGF) receptor components and a multimerizing component, wherein the first VEGF receptor component is an immunoglobulin-like (Ig) domain 2 of Flt1, the second VEGF receptor component is an Ig domain 3 of a Flk1 or Flt4, and the multimerizing component is selected from the group consisting of (i) a multimerizing component comprising a cleavable region (C-region), (ii) a truncated multimerizing component, (iii) an amino acid sequence between 1 to about 200 amino acids in length having at least one cysteine residue, (iv) a leucine zipper, (v) a helix loop motif, (vi) a coil-coil motif, and (vii) an immunoglobulin domain. Examples of the VEGF inhibitors useful in the method of the invention include fusion proteins encoded by a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO:1, 3, 5, 22, and a nucleotide sequence which, as a result of the degeneracy of the genetic code, differs from the nucleotide sequence of SEQ ID NO:1, 3, 5, or 22, and fusion protein selected from the group consisting of SEQ ID NO:2 (Flt1D2.Flk1D3Fc.DELTA.C1(a)), SEQ ID NO:4 (Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)), SEQ ID NO:6 (VEGFR1R2 Fc.DELTA.C1(a)) and (SEQ ID NO:23).

Therapeutic Methods

The present invention also has diagnostic and therapeutic utilities. In particular embodiments of the invention, methods of detecting aberrancies in the function or expression of the chimeric polypeptide molecules described herein may be used in the diagnosis of disorders. In other embodiments, manipulation of the chimeric polypeptide molecules or agonists or antagonists which bind the chimeric polypeptide molecules may be used in the treatment of diseases. In further embodiments, the chimeric polypeptide molecule is utilized as an agent to block the binding of a binding agent to its target.

By way of example, but not limitation, the method of the invention may be useful in treating clinical conditions that are characterized by vascular permeability, edema or inflammation such as brain edema associated with injury, stroke or tumor; edema associated with inflammatory disorders such as psoriasis or arthritis, including rheumatoid arthritis; asthma; generalized edema associated with burns; ascites and pleural effusion associated with tumors, inflammation or trauma; chronic airway inflammation; capillary leak syndrome; sepsis; kidney disease associated with increased leakage of protein; and eye disorders such as age related macular degeneration and diabetic retinopathy.

Combination Therapies

In numerous embodiments, a VEGF inhibitor may be administered in combination with one or more additional compounds or therapies, including a second VEGF inhibitor. Combination therapy includes administration of a single pharmaceutical dosage formulation which contains a VEGF inhibitor molecule and one or more additional agents; as well as administration of a VEGF inhibitor and one or more additional agent(s) in its own separate pharmaceutical dosage formulation. For example, a VEGF inhibitor and a cytotoxic agent, a chemotherapeutic agent or a growth inhibitory agent can be administered to the patient together in a single dosage composition such as a combined formulation, or each agent can be administered in a separate dosage formulation. Where separate dosage formulations are used, the VEGF-specific fusion protein of the invention and one or more additional agents can be administered concurrently, or at separately staggered times, i.e., sequentially. The therapeutic methods of the invention may also be combined with other agents or medical procedures used for treatment of eye disorders.

Treatment Population

The eye comprises several structurally and functionally distinct vascular beds, which supply ocular components critical to the maintenance of vision. These include the retinal and choroidal vasculatures, which supply the inner and outer portions of the retina, respectively, and the limbal vasculature located at the periphery of the cornea. Injuries and diseases that impair the normal structure or function of these vascular beds are among the leading causes of visual impairment and blindness. For example, diabetic retinopathy is the most common disease affecting the retinal vasculature, and is the leading cause of vision loss among the working age population in the United States. Vascularization of the cornea secondary to injury or disease is yet another category of ocular vascular disease that can lead to severe impairment of vision.

"Macular degeneration" is a medical term that applies to any of several disease syndromes which involve a gradual loss or impairment of eyesight due to cell and tissue degeneration of the yellow macular region in the center of the retina. Macular degeneration is often characterized as one of two types, non-exudative (dry form) or exudative (wet form). Although both types are bilateral and progressive, each type may reflect different pathological processes. The wet form of age-related macular degeneration (AMD) is the most common form of choroidal neovascularization and a leading cause of blindness in the elderly. AMD affects millions of Americans over the age of 60, and is the leading cause of new blindness among the elderly. It is characterized and usually diagnosed by the presence of elevated levels of two types of cellular debris within the retina, called drusen and lipofuscin.

There are several types of symptomatic treatment, however, that have been used with limited and isolated success, depending on the particular condition of the patient, to treat exudative (wet form) macular degeneration. Laser photocoagulation therapy may benefit certain patients with macular degeneration. However, there are high recurrence rates for selected choroidal neovascular membranes which may initially respond to laser therapy. Vision loss may also result from the laser therapy. Low dose radiation (teletherapy) has also been hypothesized as a possible treatment to induce regression of choroidal neovascularization. Surgical removal of neovascular membranes is another possible treatment, but it is a highly specialized procedure and reportedly has not had promising results to date. There is presently no effective treatment for non-exudative (dry form) macular degeneration. Management of non-exudative macular degeneration is limited to early diagnosis and careful follow-up to determine if the patient develops choroidal neovascularization. Protection against exposure to ultraviolet light and prescribed dosages of anti-oxidant vitamins (e.g., vitamin A, .beta.-carotene, lutein, zeaxanthin, vitamin C and vitamin E) and zinc may also be of some benefit, but as yet these treatments remain unproven.

Accordingly, the population to be treated by the method of the invention is preferably one of (i) a human subject diagnosed as suffering from macular degeneration, (ii) a human subject diagnosed as suffering from diabetes-related retinopathy, and (iii) a human subject suffering from pathological vascularization of the cornea secondary to injury or disease.

Methods of Administration and Compositions

Preferably, administration of the VEGF inhibitor will be directly to the eye, e.g., topical. Topical methods of administration include, for example, by eye drops, subconjunctival injections or implants, intravitreal injections or implants, sub-Tenon's injections or implants, incorporation in surgical irrigating solutions, etc.

Compositions suitable for topical administration are known to the art (see, for example, US Patent Application 2005/0059639). In various embodiments, compositions of the invention can comprise a liquid comprising an active agent in solution, in suspension, or both. As used herein, liquid compositions include gels. Preferably the liquid composition is aqueous. Alternatively, the composition can take form of an ointment. In a preferred embodiment, the composition is an in situ gellable aqueous composition, more preferably an in situ gellable aqueous solution. Such a composition can comprise a gelling agent in a concentration effective to promote gelling upon contact with the eye or lacrimal fluid in the exterior of the eye. Aqueous compositions of the invention have ophthalmically compatible pH and osmolality. The composition can comprise an ophthalmic depot formulation comprising an active agent for subconjunctival administration. The microparticles comprising active agent can be embedded in a biocompatible pharmaceutically acceptable polymer or a lipid encapsulating agent. The depot formulations may be adapted to release all or substantially all the active material over an extended period of time. The polymer or lipid matrix, if present, may be adapted to degrade sufficiently to be transported from the site of administration after release of all or substantially all the active agent. The depot formulation can be a liquid formulation, comprising a pharmaceutical acceptable polymer and a dissolved or dispersed active agent, Upon injection, the polymer forms a depot at the injections site, e.g. by gelifying or precipitating. The composition can comprise a solid article that can be inserted in a suitable location in the eye, such as between the eye and eyelid or in the conjuctival sac, where the article releases the active agent. Solid articles suitable for implantation in the eye in such fashion generally comprise polymers and can be bioerodible or non-bioerodible.

In one embodiment of the method of the invention, a human subject with at least one visually impaired eye is treated with 25-4000 ug of a VEGF inhibitor protein via intravitreal injection. Improvement of clinical symptoms are monitored by one or more methods known to the art, for example, indirect ophthalmoscopy, fundus photography, fluorescein angiopathy, electroretinography, external eye examination, slit lamp biomicroscopy, applanation tonometry, pachymetry, and autorefaction. Subsequent doses may be administered weekly or monthly, e.g., with a frequency of 2-8 weeks or 1-12 months apart.

Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.

EXAMPLES

Example 1

Modified Flt1 Receptor Vector Construction

Chimeric molecules were constructed, denoted R1R2 (Flt1.D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a) and R1R3 (Flt1D2.VEGFR3D3-Fc.DELTA.C1(a) and VEGFR1R3-Fc.DELTA.C1(a) respectively, wherein R1 and Flt1D2=Ig domain 2 of Flt1 (VEGFR1); R2 and Flk1D3=Ig domain 3 of Flk1 (VEGFR2); and R3 and VEGFR3D3=Ig domain 3 of Flt4 (VEGFR3)) were much less sticky to ECM, as judged by an in vitro ECM binding assay and had greatly improved PK as described herein. In addition, these molecules were able to bind VEGF tightly and block phosphorylation of the native Flk1 receptor expressed in endothelial cells.

Construction of the expression plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a). Expression plasmids pMT21.Flt1(1-3).Fc (6519 bp) and pMT21.Flk-1(1-3).Fc (5230 bp) are plasmids that encode ampicillin resistance and Fc-tagged versions of Ig domains 1-3 of human Flt1 and human Flk1, respectively. These plasmids were used to construct a DNA fragment consisting of a fusion of Ig domain 2 of Flt1 with Ig domain 3 of Flk1, using PCR amplification of the respective Ig domains followed by further rounds of PCR to achieve fusion of the two domains into a single fragment. For Ig domain 2 of Flt1, the 5' and 3' amplification primers were as follows: 5': bsp/flt1D2 (5'-GACTAGCAGTCCGG-AGGTAGACCTTTCGTAGAGATG-3') (SEQ ID NO:8), 3': Flt1D2-Flk1D3.as (5'-CGGACTCAGAACCACATCTATGATTGTATTGGT-3') (SEQ ID NO:9). The 5' amplification primer encodes a BspE1 restriction enzyme site upstream of Ig domain 2 of Flt1, defined by the amino acid sequence GRPFVEM (SEQ ID NO:10) corresponding to amino acids 27-33 of SEQ ID NO:2. The 3' primer encodes the reverse complement of the 3' end of Flt1 Ig domain 2 fused directly to the 5' beginning of Flk1 Ig domain 3, with the fusion point defined as TIID of Flt1 (corresponding to amino acids 123-126 of SEQ ID NO:2) and continuing into VVLS (SEQ ID NO:7) (corresponding to amino acids 127-130 of SEQ ID NO:2) of Flk1.

For Ig domain 3 of Flk1, the 5' and 3' amplification primers were as follows:5': Flt1D2-Flk1D3.s (5'-ACAATCATAGATGTGGTTCTGAGTCCGTCTCATGG-3') (SEQ ID NO:11); 3': Flk1D3/apa/srf.as (5'-GATAATGCCCGGGCCCTTTTCATGGACCCTGACAAATG-3') (SEQ ID NO:12). The 5' amplification primer encodes the end of Flt1 Ig domain 2 fused directly to the beginning of Flk1 Ig domain 3, as described above. The 3' amplification primer encodes the end of Flk1 Ig domain 3, defined by the amino acids VRVHEK (SEQ ID NO:13) (corresponding to amino acids 223-228 of SEQ ID NO:2), followed by a bridging sequence that includes a recognition sequence for the restriction enzyme Srf1, and encodes the amino acids GPG. The bridging sequence corresponds to amino acids 229-231 of SEQ ID NO:2.

After a round of PCR amplification to produce the individual domains, the products were combined in a tube and subjected to a further round of PCR with the primers bsp/flt1D2 and Flk1D3/apa/srf.as (described supra) to produce the fusion product. This PCR product was subsequently digested with the restriction enzymes BspEI and SmaI and the resulting 614 bp fragment was subcloned into the BspEI to SrfI restriction sites of the vector pMT21/.DELTA.B2.Fc, to create the plasmid pMT21/Flt1D2.Flk1D3.Fc. The nucleotide sequence of the Flt1D2-Flk1D3 gene fusion insert was verified by standard sequence analysis. This plasmid was then digested with the restriction enzymes EcoRI and SrfI and the resulting 702 bp fragment was transferred into the EcoRI to SrfI restriction sites of the plasmid pFlt1(1-3)B2-Fc.DELTA.C1(a) to produce the plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a). The complete DNA and deduced amino acid sequences of the Flt1D2.Flk1D3.Fc.DELTA.C1(a) chimeric molecule is shown in SEQ ID NO:1-2.

Construction of the expression plasmid pFlt1D2VEGFR3D3Fc.DELTA.C1(a). The expression plasmid pMT21.Flt1(1-3).Fc (6519 bp) encodes ampicillin resistance and an Fc-tagged version of Ig domains 1-3 of human Flt1 receptor. This plasmid was used to produce a DNA fragment containing Ig domain 2 of Flt1 by PCR. RNA from the cell line HEL921.7 was used to produce Ig domain 3 of Flk1, using standard RT-PCR methodology. A further round of PCR amplification was used to achieve fusion of the two Ig domains into a single fused fragment. For Ig domain 2 of Flt1, the 5' and 3' amplification primers were as follows: 5': bsp/flt1D2 (5'-GACTAGCAGTCCGGAGGTAGACCTTT-CGTAGAGATG-3') (SEQ ID NO:14), 3': Flt1D2.VEGFR3D3.as (TTCCTGGGCAACAGCTGGATA-TCTATGATTGTATTGGT) (SEQ ID NO:15). The 5' amplification primer encodes a BspE1 restriction site upstream of Ig domain 2 of Flt1, defined by the amino acid sequence GRPFVEM (SEQ ID NO:10) (corresponding to amino acids 27-33 of SEQ ID NO:1-2). The 3' amplification primer encodes the reverse complement of the end of Flt1 Ig domain 2 fused directly to the beginning of VEGFR3 Ig domain 3, with the fusion point defined as TIID of Flt1 (corresponding to amino acids 123-126 of SEQ ID NO:4) and continuing into IQLL of VEGFR3 (corresponding to amino acids 127-130 of SEQ ID NO:4).

For Ig domain 3 of VEGFR3, the 5' and 3' primers used for RT-PCR were as follows: 5': R3D3.s (ATCCAGCTGTTGCCCAGGAAGTCGCTGGAGCTGCTGGTA) (SEQ ID NO:17), 3': R3D3.as (ATTTTCATGCACAATGACCTCGGTGCTCTCCCGAAATCG) (SEQ ID NO:18). Both the 5' and 3' amplification primers match the sequence of VEGFR3. The 296 bp amplification product of this RT-PCR reaction was isolated by standard techniques and subjected to a second round of PCR to add suitable sequences to allow for fusion of the Flt1D2 with the Flk1D3 domains and fusion of the Flk1D3 and Fc domains via a GPG bridge (see below). The amplification primers were as follows: 5':Flt1D2.VEGFR3D3.s(TCATAGATATCCAGCTGTTGCCCAGGAAGTCGCTGGAG) (SEQ ID NO:19), 3': VEGFR3D3/srf.as (GATAATGCCCGGGCCATTTTCATGCACAATGACCTCGGT) (SEQ ID NO:20). The 5' amplification primer encodes the 3' end of Flt1 Ig domain 2 fused directly to the beginning (5' end) of VEGFR3 Ig domain 3, as described above. The 3' amplification primer encodes the 3' end of VEGFR3 Ig domain 3, defined by the amino acids VIVHEN (SEQ ID NO:21) (corresponding to amino acids 221-226 of SEQ ID NO:4), followed by a bridging sequence that includes a recognition sequence for Srf1, and encodes the amino acids GPG. The bridging sequence corresponds to amino acids 227-229 of SEQ ID NO:4.

After one round (for Flt1 Ig domain 2) or two rounds (for Flt4 Ig domain 3) of PCR to produce the individual Ig domains, the PCR products were combined in a tube and subjected to a further round of PCR amplification with the amplification primers bsp/flt1D2 and VEGFR3D3/srf.as described supra, to produce the fusion product. This PCR product was subsequently digested with the restriction enzymes BspEI and SmaI and the resulting 625 bp fragment was subcloned into the BspEI to SrfI restriction sites of the vector pMT21/Flt1.DELTA.B2.Fc (described supra), to create the plasmid pMT21/Flt1D2.VEGFR3D3.Fc. The sequence of the Flt1D2-VEGFR3D3 gene fusion insert was verified by standard sequence analysis. This plasmid was then digested with the restriction enzymes EcoRI and SrfI and the resulting 693 bp fragment was subcloned into the EcoRI to SrfI restriction sites of the plasmid pFlt1(1-3).DELTA.B2-Fc.DELTA.C1(a) to produce the plasmid designated pFlt1D2.VEGFR3D3.Fc.DELTA.C1(a). The complete DNA deduced amino acid sequence of the Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) chimeric molecule is shown in SEQ ID NO:3-4.

Example 2

Construction pVEGFR1R2-Fc.DELTA.C1(a) Expression Vector

The pVEGFR1R2.Fc.DELTA.C1(a) (SEQ ID NO:15-16) expression plasmid was constructed by insertion of DNA encoding amino acids SDT (corresponding to amino acids 27-29 of SEQ ID NO:6) between Flt1d2-Flk1d3-Fc.DELTA.C1(a) amino acids 26 and 27 of SEQ ID NO:2 (GG) and removal of DNA encoding amino acids GPG corresponding to amino acids 229-231. The SDT amino acid sequence is native to the Flt1 receptor and was added back in to decrease the likelihood of heterogeneous N-terminal processing. The GPG (bridging sequence) was removed so that the Flt1 and Flk1 Ig domains were fused directly to one another. The complete DNA and deduced amino acid sequences of the pVEGFR1R2.Fc.DELTA.C1(a) chimeric molecule is shown in SEQ ID NO:5-6.

Example 3

Cell Culture Process Used to Produce Modified Flt1 Receptors

Cell Culture Process Used to Produce Flt1D2.Flk1D3.Fc.DELTA.C1(a). The process for production of Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein using the expression plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a) involves suspension culture of recombinant Chinese hamster ovary (CHO K1/E1A) cells which constitutively express the protein product. The cells are grown in bioreactors and the protein product is isolated and purified by affinity and size exclusion chromatography.

Cell Expansion. Two confluent T-225 cm.sup.2 flasks containing the Flt1D2.Flk1D3.Fc.DELTA.C1(a) expressing cell line were expanded by passaging cells into eight T-225 cm.sup.2 flasks in medium (GMEM+10% serum, GIBCO) and incubated at 37.degree. C. and 5% CO.sub.2. When the flasks approached confluence (approximately 3 to 4 days) the cells were detached using trypsin. Fresh medium was added to protect the cells from further exposure to the trypsin. The cells were centrifuged and resuspended in fresh medium then transferred to eight 850 cm.sup.2 roller bottles and incubated at 37.degree. C. and 5% CO.sub.2 until confluent.

Suspension Culture in Bioreactors. Cells grown in roller bottles were trypsinized to detach them from the surface and washed with suspension culture medium. The cells are aseptically transferred to a 5 L bioreactor (New Brunswick Celligen Plus) where the cells are grown in 3.5 L of suspension culture. The suspension culture medium was a glutamine-free low glucose modification of IS-CHO (Irvine Scientific) to which 5% fetal bovine serum (Hyclone), GS supplement (Life Technologies) and 25 .mu.M methionine sulfoximine (Sigma) was added. The pH was controlled at 7.2 by addition of carbon dioxide to the inlet gas or by addition of a liquid solution of sodium carbonate to the bioreactor. Dissolved oxygen level was maintained at 30% of saturation by addition of oxygen or nitrogen to the inlet gas and temperature controlled at 37.degree. C. When a density of 4.times.10.sup.6 cells/mL was reached the cells were transferred to a 40 L bioreactor containing the same medium and setpoints for controlling the bioreactor. The temperature setpoint was reduced to 34.degree. C. to slow cell growth and increase the relative rate of protein expression.

Cell Culture Process Used to Produce Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The same methodologies as described supra for Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to produce Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).

Example 4

Harvest and Purification of Modified Flt1 Receptors

Harvest and Purification of Flt1D2.Flk1D3.Fc.DELTA.C1(a). The product protein was aseptically harvested from the bioreactor while retaining cells using Millipore Prostak tangential-flow filtration modules and a low-shear mechanical pump (Fristam). Fresh medium was added to the bioreactor to replace that removed during the harvest filtration. Approximately 40L of harvest filtrate was then loaded onto a 400 mL column containing Protein A Sepharose resin (Amersham Pharmacia). After loading the resin was washed with buffer containing 10 mM sodium phosphate, 500 mM sodium chloride, pH 7.2 to remove any unbound contaminating proteins. Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein was eluted with a pH 3.0 citrate buffer. The eluted protein was neutralized by addition of Tris base and frozen at -20.degree. C.

Several frozen lots of Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein from the Protein A step above were thawed, pooled and concentrated using a Millipore 30 kD nominal molecular weight cutoff (NMWCO) tangential flow filtration membrane. The protein was transferred to a stirred cell concentrator (Millipore) and further concentrated to 30 mg/mL using a 30 kD NMWCO membrane. The concentrated protein was loaded onto a size exclusion column packed with Superdex 200 resin (Amersham Pharmacia) that was equilibrated with phosphate buffered saline plus 5% glycerol. The same buffer was used to run the column. The fractions corresponding to Flt1D2.Flk1D3.Fc.DELTA.C1(a) dimer were pooled, sterile filtered through a 0.22 micron filter, aliquoted and frozen.

Harvest and Purification of Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The same methodologies as described supra for Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to harvest and purify Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).

Example 5

Binding Stoichiometry of Modified Flt Receptors to VEGF165

Biacore Analysis. The stoichiometry of Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a) interaction with human VEGF165 was determined by measuring either the level of VEGF saturation binding to the Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) surfaces or measuring concentration of VEGF165 needed to completely prevent binding of Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) to VEGF Biacore chip surface.

Modified Flt receptors Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a), were captured with an anti-Fc specific antibody that was first immobilized on a Biacore chip (BIACORE) using amine-coupling chemistry. A blank antibody surface was used as a negative control. VEGF165 was injected at a concentration of 1 nM, 10 nM, and 50 nM over the Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a) surfaces at 10 .mu.l/min for one hour. A real-time binding signal was recorded and saturation binding was achieved at the end of each injection. Binding stoichiometry was calculated as a molar ratio of bound VEGF165 to the immobilized Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a), using the conversion factor of 1000 RU equivalent to 1 ng/ml. The results indicated binding stoichiometry of one VEGF165 dimeric molecule per one Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) molecule (FIG. 1).

In solution, Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) at a concentration of 1 nM (estimated to be 1000 times higher than the KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a)/VEGF165 interaction) were mixed with varied concentrations of VEGF165. After one hour incubation, concentrations of the free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution were measured as a binding signal to an amine-coupled VEGF165 surface. A calibration curve was used to convert the Flt1D2Flk1D3.Fc.DELTA.C1(a) Biacore binding signal to its molar concentration. The data showed that the addition of 1 nM VEGF165 into the Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocked Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This result suggested the binding stoichiometry of one VEGF165 molecule per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule. When the concentration of Flt1D2Flk1D3.Fc.DELTA.C1(a) was plotted as a function of added concentration of VEGF165, the slope of the linear portion was -1.06 for Flt1D2Flk1D3.Fc.DELTA.C1(a) and -1.07 for VEGFR1R2-Fc.DELTA.C1(a). The magnitude of the slope, very close to negative one, was indicative that one molecule of VEGF165 bound to one molecule of either Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a).

Size Exclusion Chromatography. Flt1D2Flk1D3.Fc.DELTA.C1(a) was mixed with a 3-fold excess of VEGF165 and the receptor-ligand complex was purified using a Pharmacia Superose 6 size exclusion chromatography column. The receptor-ligand complex was then incubated in a buffer containing 6M guanidine hydrochloride in order to dissociate it into its component proteins. Flt1D2Flk1D3.Fc.DELTA.C1(a) was separated from VEGF165 using Superose 6 size exclusion chromatography column run in 6M guanidium chloride. In order to determine complex stoichiometry, several injections of Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGF165 were made and peak height or peak integrated intensity was plotted as a function of the concentration of injected protein. The calibration was done under conditions identical to those used in separating components of Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex. Quantification of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex composition was based on the calibration curves. The results of this experiment (FIG. 1) shows the ratio of VEGF165 to Flt1D2Flk1D3.Fc.DELTA.C1(a) in a complex to be 1:1.

Example 6

Pharmacokinetic Analysis of Modified Flt Receptors

Pharmacokinetic analysis of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a). Balb/c mice (25-30 g) were injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc (A40), CHO transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a), CHO stably expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently expressed VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 4, 6, 24 hrs, 2 days, 3 days and 6 days after injection. The sera were assayed in an ELISA designed to detect Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The ELISA involves coating an ELISA plate with VEGF165, binding the detect Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) and reporting with an anti-Fc antibody linked to horse radish peroxidase. The results of this experiments are shown in FIG. 2. The T.sub.max for Flt1(1-3)-Fc (A40) was at 6 hrs while the T.sub.max for the transient and stable Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the transient VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for Flt1(1-3)-Fc (A40) was 8 .mu.g/ml. For both transients (Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a)) the C.sub.max was 18 .mu.g/ml and the C.sub.max for the stable VEGFR1R2-Fc.DELTA.C1(a) was 30 .mu.g/ml.

Pharmacokinetic analysis of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). Balb/c mice (25-30 g) were injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc (A40), CHO transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5, 6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed in an ELISA designed to detect Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The ELISA involves coating an ELISA plate with 165, binding the Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) or Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) and reporting with an anti-Fc antibody linked to horse radish peroxidase. Flt1(1-3)-Fc (A40) could no longer be detected in the serum after day 5, whereas, Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) were detectable for 15 days or more. The results of this experiment are shown in FIG. 3.

Example 7

Breakdown of Blood-retinal Barrier Reversed by Inhibition of VEGF

Rats received a single injection of VEGFR1R2-Fc.DELTA.C1(a) (SEQ ID NO:6) (25 mg/kg, i.p.) or PBS 4 weeks after induction of diabetes by streptozotocin (65 mg/kg, i.v.). The permeability of retinal vessels was assessed 24 hours later by measuring the extravasation of Evans Blue dye, which binds to albumin in the circulation. Under deep anesthesia, Evans Blue dye (45 mg/kg) was injected intravenously, and allowed to circulate for 60 minutes, and blood samples were taken periodically to assess the concentration of dye in the circulation. The animals were then perfused to flush dye and blood from the vasculature, the eye enucleated and the retinas removed. Evans blue was extracted, and the concentration of dye in the retina was normalized to retinal weight and the time-averaged concentration of Evans blue in the circulation (.quadrature.L plasma.times.g retina weight.sup.-1.times.hr.sup.-1) to provide an index of vascular leak. VEGFR1R2-Fc.DELTA.C1(a) normalized retinal vascular permeability to levels evident in non-diabetic rats.

Example 8

VEGFR1R2-Fc.DELTA.C1(a) Prevents Neovascularization Induced by Retinal Ischemia

Excessive upregulation of VEGF expression is responsible for pathologic neovascularization in many retinal diseases. The anti-angiogenic properties of VEGFR1R2-Fc.DELTA.C1(a) were investigated in a mouse model of oxygen-induced ischemic retinopathy (OIR). OIR was produced by transiently exposing mouse pups to increased ambient oxygen (hyperoxia), resulting in obliteration of the developing microvasculature within the central retina. Subsequent return of the animals to room air results in relatively hypoxic conditions in the retina, which in turn stimulates an angiogenic response that shares features with both diabetic retinopathy, retinopathy of prematurity and other ischemic retinopathies. VEGFR1R2-Fc.DELTA.C1(a) (25 mg/kg, ip) was administered every other day beginning 12-24 hours after returning the mice from hyperoxia to room air. Littermate controls received injections of human Fc following the same schedule. Retinas were collected 1 week following return to room air. Flat mounts were prepared from one retina obtained from each animal, and the retinal vessels stained with fluoresceinated lectin (Griffonia simplicifolia). The other retina was embedded and cross-sections were cut and stained with hematoxylin and eosin.

Retinas of all control mice exposed to hyperoxia exhibited marked pathologic angiogenesis, characterized by the presence of vascular tufts penetrating the inner limiting membrane and chaotic sprouting of vessels on the surface of the retina, particularly around the optic nerve head. Administration of VEGFR1R2-Fc.DELTA.C1(a) almost completely blocked the development of these vascular abnormalities as quantitated by counting endothelial cell nuclei in the abnormal pre-retinal vessels (FIG. 4). Although pathologic angiogenesis was dramatically inhibited, systemic administration of VEGFR1R2-Fc.DELTA.C1(a) did not block the growth of normal-appearing intraretinal vessels in these animals.

Example 9

Suppression of Choroidal Neovascularization

Though animals do not develop age related macular degeneration (AMD) per se, choroidal neovascularization resembling that seen in AMD can be produced by using a laser to produce focal disruptions in Bruch's membrane and the overlying retinal pigment epithelium (RPE). This injury stimulates the abnormal growth of underlying choroidal capillaries into the RPE layer and subretinal space. Disruption of Bruch's membrane is common to all forms of choroidal neovascularization (CNV), including that which characterizes the wet form of AMD. In the laser-induced model of choroidal neovascularization, groups of 9 or 10 mice were treated with subcutaneous (sc) injections of 25 mg/kg of VEGFR1R2-Fc.DELTA.C1(a) or human Fc one day prior to laser injury and on days 2, 5, 8, and 11 after laser. At 14 days after laser injury, the mice were injected intravenously with fluorescein-labeled dextran (50 mg), euthanized, and eyes were rapidly dissected for choroidal flat mounts or frozen in optimum cutting temperature embedding compound and sectioned for evaluation of the lesions. VEGFR1R2-Fc.DELTA.C1(a) administration reduced the area of CNV lesions by approximately 70% (FIG. 5).

The effect of VEGFR1R2-Fc.DELTA.C1(a) on laser-induced choroidal neovascularization also was evaluated in adult cynomolgus monkeys. In this experiment, VEGFR1R2-Fc.DELTA.C1(a) was administered by intravenous or intravitreal injection. Each animal received nine or ten laser burns to each retina, and the development of active choroidal neovascular lesions was assessed by fluorescein angiography, once before the initiation of treatment and 15, 20 and 29 days postlaser. VEGFR1R2-Fc.DELTA.C1(a) was administered intravenously once per week, beginning one week before laser injury, at a dose of 3 mg/kg or 10 mg/kg. Intravitreal injections were made once every two weeks, at a dose of 50, 250 or 500 mcg/eye beginning one week before laser, or once, two weeks following laser (500 mcg dose only), at which time active CNV lesions had already formed. Control animals received weekly intravenous or biweekly intravitreal injections of placebo, beginning one week before laser. Each of the above experimental and control groups comprised six animals, 3 males and 3 females. CNV lesions were visualized by fluorescein angiography and graded. Active CNV lesions characterized bright hyperfluorescence, with late leakage beyond the borders of the laser spot (Grade 4), developed at 32% and 48% of the laser burn sites, in animals receiving intravitreal or intravenous administration of placebo. In contrast, the development of grade 4 lesions was completely or nearly completely prevented in all groups of animals receiving intravenous or intravitreal injections of VEGFR1R2-Fc.DELTA.C1(a) (FIG. 9). Moreover a single intravitreal injection (500 mcg) of VEGFR1R2-Fc.DELTA.C1(a) made following the laser injury reduced the incidence of grade 4 lesions from 44% to 0% within 10 days of treatment (FIG. 9).

Example 10

Inhibition of Subretinal Neovascularization in rho/VEGF Transgenic Mice

Transgenic mice expressing a recombinant human VEGF transgene under the control of the rhodopsin promoter (Rho/VEGF) were used in these experiments. These animals begin to express VEGF in photoreceptors on about postnatal day (P) 7, which typically results in pronounced subretinal neovascularization by P21. At P7, mice were divided into 2 groups and treated with 25 mg/kg of VEGFR1R2-Fc.DELTA.C1(a) (9 mice, 17 eyes) or human Fc (10 mice, 19 eyes) on P7, P10, P13, P16, and P19. On P21, the mice were anesthetized and perfused with fluorescein-labeled dextran. Retinal whole mounts from mice treated with VEGFR1R2-Fc.DELTA.C1(a) showed few areas of neovascularization while many new vessels were present in the subretinal space of mice that had been treated with Fc. Measurement of the total area of neovascularization per retina by image analysis showed significantly less neovascularization in VEGFR1R2-Fc.DELTA.C1(a)-treated mice, compared to those treated with Fc (FIG. 6).

Example 11

Suppression of VEGF-induced Breakdown of the Blood-Retinal Barrier

Adult C57BL/6 mice were given a sc injection of 25 mg/kg of VEGFR1R2-Fc.DELTA.C1(a) or Fc fragment and on the following day received an intravitreous injection of 1 .mu.l of 10.sup.-6 M VEGF. Six hours later, retinal vascular permeability was measured using [.sup.3H]-mannitol as a tracer. Mice treated with VEGFR1R2-Fc.DELTA.C1(a) (9 mice, 18 eyes) had a significantly smaller retina to lung leakage ratio (the ratio of radioactivity in the retina compared to excised lung) than mice treated with Fc fragment (9 mice, 18 eyes) indicating less breakdown of the blood retinal barrier (FIG. 7A).

The effect of VEGFR1R2-Fc.DELTA.C1(a) on VEGF-mediated vascular leak was also evaluated in a second experiment, which employed double transgenic mice (rtTA/rho-TRE/VEGF). These mice are characterized by photoreceptor-specific expression of the VEGF transgene that is inducible by administration of doxycycline. Adult rtTA/rho-TRE/VEGF mice were injected sc with 25 mg/kg VEGFR1R2-Fc.DELTA.C1(a) (10 mice, 20 eyes) or Fc fragment (10 mice, 20 eyes). On the following day, doxycycline (2 mg/mL) was placed in their drinking water to stimulate over-expression of VEGF within the retina. Two days later, they were given a second sc injection of VEGFR1R2-Fc.DELTA.C1(a) or Fc fragment and then the next day retinal vascular permeability was measured with [.sup.3H]-mannitol. Mice treated with VEGFR1R2-Fc.DELTA.C1(a) exhibited a significant reduction in the retina to lung leakage ratio compared to mice treated with Fc (FIG. 7B), indicating that impairment in the blood-retinal barrier was ameliorated.

Example 12

Inhibition Injury-Induced Corneal Neovascularization

Corneal neovascularization was induced in male C57BI/6 mice by intrastromal placement of 3 nylon sutures, or by chemical injury (NaOH) and mechanical debridement of the corneal epithelium. Multiple experiments were conducted in which VEGFR1R2-Fc.DELTA.C1(a) was administered intraperitoneally once or at multiple time points immediately before or following injury. The growth of corneal neovessels was evaluated by slit-lamp microscopy and histological evaluation. The vasculature was labeled with an endothelial cell specific fluorescein-conjugated lectin, and neovascularization was evaluated in corneal flat-mounts, as well as in cross sections using PECAM immunohistochemistry. The presence of corneal edema was evaluated, using slit lamp microscopy, and corneal thickness was measured in cross-sections; increases in corneal thickness reflect the amount of edema. The numbers of polymorphonuclear leukocytes (PMN) and macrophages were determined by staining cross-sections with HEMA-3 or rat anti-mouse F4/80 monoclonal antibody, respectively.

Dosing regimens which employed multiple injections of VEGFR1R2-Fc.DELTA.C1(a) (25 mg/kg, ip) comple


Free Web Sudoku Puzzles.
Solve with your browser.
  3         6 5  
    9   6 8 3    
      5     7   1
        3     2 9
      4   1      
1 7     9        
5   7     6      
    6 3 8   4    
  4 3         6  
What is it?



Add Your Site · Terms Of Service · Privacy Policy


DISCLAIMER
Linkgrinder is a free service that searches the Internet and indexes all files found so that you may search quickly and easily for shared files. These files are created and made available individually by users whose identity we are not aware of and who we have no control over. In essence we function like a search engine tool; these files ARE NOT STORED OR SERVED BY OUR NETWORK. We are not responsible for any materials obtained by using our service. We do not monitor any of the contents of these files. These files may contain viruses, illegal materials, materials inappropriate for minors, offensive files and the like. BY USING OUR SERVICE, YOU ASSUME FULL RESPONSIBILITY FOR DOWNLOADING THESE MATERIALS AND WILL INDEMNIFY US FOR ANY DAMAGES THAT MAY BE INCURRED.

For More Specific Information VIEW OUR TERMS OF SERVICE.

Thank you and Enjoy!