Title: p53 as protein and antibody therefor
Abstract: In accordance with the present invention, we have discovered and purified a protein designated herein as p53as, which protein is present in normal cells of a mammal and is essentially identical to known normal growth controlling protein p53 of the same mammal, at least until the final 50 amino acids of the carboxy terminal end of the protein. The invention further includes an antibody specific for protein p53as, which antibody is designated herein as Ab p53as. The antibody may be either a monoclonal or polyclonal antibody and may be specific for p53as of any particular mammal such as mice ard humans.
Patent Number: 6,965,009 Issued on 11/15/2005 to Kulesz-Martin
| Inventors:
|
Kulesz-Martin; Molly F. (Buffalo, NY)
|
| Assignee:
|
Health Research, Inc. (Buffalo, NY)
|
| Appl. No.:
|
811361 |
| Filed:
|
March 4, 1997 |
| Current U.S. Class: |
530/326 |
| Intern'l Class: |
C07K 007/00 |
| Field of Search: |
530/326
|
References Cited [Referenced By]
U.S. Patent Documents
| 4786718 | Nov., 1988 | Weinberg et al.
| |
| Foreign Patent Documents |
| A-O-529160 | Mar., 1993 | EP.
| |
| PCT/US92/00878 | Jan., 1992 | WO.
| |
| WO-A-9213970 | Aug., 1992 | WO.
| |
Other References
Bowie et al (Science, 1990, 257:1306-1310).
Burgess et al (J of Cell Bio. 111:2129-2138, 1990).
Scott et al (Nature Genetics, 1999, 21:440-443).
Bork (Genome Research, 2000, 10:398-400).
Arai et al. Molecular and Cellular Biology Sep. 1986 p 3232 3239 vol. 6.
Kulesz-Martin, Molly F. et al. "Endogenous p53 Protein Generated from Wild-Type
Alternatively Spliced p53 RNA in Mouse Epidermal Cells", Mol. and Cell. Biol. Mar.
1994, p. 1698-1708.
Wu, Yu et al., "Activities and Response to DNA Damage of Latent and Active Sequence-Specific
DNA Binding Forms of Mouse p53", Proc. Natl. Acad. Sci., vol. 94, pp. 8982-8987,
Aug. 1997.
Cruse et al., "Illustrated Dictionary of Immunology," CRC Press, p. 280.
Kulesz-Martin, M. t al., "Endogenous Mouse p53 Protein Generated by Alternative
Splicing," J. Cellular Biochemistry Supplement, vol. 0, No. 18c, Feb. 13, 1994-Feb.
20, 1994, p. 170.
Wu, Y. et al., "Physiological Protein Varient of the Mouse p53 Tumor Suppressor
Gene," Proc. of the American Assoc. for Cancer Research, Annual Mtg., vol. 35,
Apr. 10, 1994-Apr. 13, 1994, p. 605.
Bayle, J. et al., "The Carboxyl-Terminal Domain of the p53 Protein Regulates
Sequence-Specific DNA Binding Through its Nonspecific Nucleic Acid Binding Activity,"
Proc. Nat. Acad. Sciences of USA, vol. 92, No. 12, 1995, pp. 5729-5733.
Wu, Y. et al., "Wild-Type Alternatively Spliced p53: Binding to DNA and Interaction
with the Major p53 Protein in Vitro and in Cells," The EMBO Journal, vol. 13, No.
20, 1994, pp. 4823-4830.
Sevier et al., Clin. Chem, 27: pp. 1797-1806, 1981.
Gupta et al., PNAS USA, 90: pp. 2817-2821, 1993.
Arai, N. et al., "Immunology Distinct p53 Molecules Generated by Alternative
Splicing," Mol. and Cell. Biol., 6, 1986, pp. 3232-3239.
Balmain, A. et al., "Cloning and Characterization of the Abundant Cytoplasmic
7S RNA from Mouse Cells," Nucleic Acids Res. 10, 1982, pp. 4259-4277.
Bargonetti, J. et al., "Site-Specific Binding of Wild-Type p53 to Cellular DNA
is Inhibited by SV40 T Antigen and Mutant p53," Genes & Dev. 6, 1992, pp. 1886-1898.
Bischoff, J.R. et al., "Human p53 Inhibits Growth in Schizosaccharomyces pombe,"
Mol. and Cell. Biol. 12, 1992, pp. 1405-1411.
Burns, P.A. et al., "Loss of Heterozygosity and Mutational Alterations of the
p53 Gene in Skin Tumors of Interspecific Hybrid Mice," Oncogene 6, 1991, pp. 2363-2369.
Crook, T. et al., "Modulation of Immortalizing Properties of Human Papillomavirus
Type 16E7 by p53 Expression," J. Virol. 6, 1991, pp. 505-510.
Davies, R. et al., "Antioxidants Can Delay Liver Cell Maturation Which in Turn
Affects γ-Glutamyltranspeptidase Expression," Carcinogen. 14, 1993, pp. 47-52.
Eliyahu, D. et al., "Meth A Fibrosarcoma Cells Express Two Transforming Mutant
p53 Species," Oncogene 3, 1988, pp. 313-321.
Farmer, G. et al., "Wild-Type p53 Activates Transcription in vitro," Nature 358,
1992, pp. 83-86.
Finlay, C.A. et al., "The p53 Proto-Oncogene Can Act as a Supressor of Transformation,"
Cell 57, 1989, pp. 1083-1093.
Fontoura, B.M.A. et al., "p53 is Covalently Linked to 5.8S rRNA," Mol. Cell.
Biol. 12, 1992, pp. 5145-5151.
Foord, O.S. et al., "A DNA Binding Domain is Contained in the C-Terminus of Wild
Type p53 Protein," Nucleic Acids Res. 19, 1991, pp. 5191-5198.
Foulkes, N.S. et al., "More is Better: Activators and Repressors from the Same
Gene," Cell 68, 1992, pp. 411-414.
Hainaut, P. et al., "Interaction of Heat-Shock Protein 70 with p53 Translated
in vitro Evidence for Interaction with Dimeric p53 and for a Role in the Regulation
of p53 Conformation," EMBO J. 11, 1992, pp. 3513-3520.
Han, K. et al., "Altered Levels of Endogenous Retrovirus-Like Sequence (VL30)
RNA During Mouse Epidermal Cell Carcinogenesis," Mol. Carcinogenesis 3, 1990, pp. 75-82.
Han, K. et al., "Altered Expression of Wild-Type 53 Tumor Supressor Gene During
Murine Epithelial Cell Transformation," Cancer Research 52, 1992, pp. 749-753.
Han, K. et al., "Alternatively Spliced p53 RNA in Transformed and Normal Cells
of Different Tissue Types," Nucleic Acids Res. 20(8), 1992, pp. 1979-1981.
Hupp, T.R. et al., "Regulation of the Specific DNA Binding Function of p53,"
Cell 71, 1992, pp. 875-886.
Jenkins, J.R. et al., "Cellular Immortalization by cDNA Clone Encoding the Transformation-Associated
Phosphoprotein p53," Nucleic Acids Res. 12, 1984, pp. 5609-5626.
Kastan, M.B. et al., "Participation of p53 Protein in the Cellular Response to
DNA Damage," Cancer Research 51, 1991, pp. 6304-6311.
Kastan, M.B. et al., "A Mammalian Cell cycle Checkpoint Pathway Utilizing p53
and GADD45 is Defective in Ataxia-Telangiectasia," Cell 71, 1992, pp. 587-597.
Kulesz-Martin, M. et al., "Mouse Cell Clones for Improved Quantitation of Carcinogen-Induced
Altered Differentiation," Carcinogenisis 6, 1985, pp. 1245-1254.
Kulesz-Martin, M. et al., "Retinoic Acid Enhancement of an Early Step in the
Transformation of Mouse Epidermal Cells in vitro," Carcinogenesis 7, 1986, pp. 1425-1429.
Kulesz-Martin, M. et al., "Pemphigoid, Pemphigus and Desmoplakin as Antigenic
Markers of Differentiation in Normal and Tumorigenic Mouse Keratinocyte Lines,"
Cell Tissue Kinet. 22, 1989, pp. 279-290.
Kulesz-Martin, M. et al., "Tumor Progression of Murine Epidermal Cells After
Treatment In vitro with 12-0-Tetradecanoylphorbol-13-Acetate or Retinoic Acid,"
Cancer Research 51, 1991, pp. 4701-4706.
Kulesz-Martin, M. et al. "Properties of Carcinogen Altered Mouse Epidermal Cells
Resistant to Calcium-Induced Terminal Differentiation," Carcinogen 4, 1983, pp. 1367-1377.
Lane, D.P., "p53, Guardian of the Genome," Nature 358, 1992, pp. 15-16.
Milne, D.M. et al., "Mutation of the Casein Kinase II Phosphorylation Site Abolishes
the Anti-Proliferative Activity of p53," Nucleic Acids Res. 20, 1992, pp. 5565-5570.
Milner, J., "The Role of p53 in the Normal Control of Cell Proliferation," Current
Opinion in Cell Biology 3, 1991, pp. 282-286.
Milner, J., "Different Forms of p53 Detected by Monoclonal Antibodies in Non-Dividing
and Dividing Lymphocytes," Nature 20, 1984, pp. 143-145.
Milner, J. et al., "Cotranslation of Activated Mutant p53 with Wilde Type Drives
the Wild-Type p53 Protein into the Mutant Conformation," Cell 65, 1991, pp. 765-774.
Momand, J. et al., "The mdm-2 Oncogene Product Forms a Complex With the p53 Protein
and Inhibits p53-Mediated Transactivation," Cell 69, 1992, pp. 1237-1245.
Nigro, J.M. et al., "Human p53 and CDC2Hs Genes Combine to Inhibit the Proliferation
of Saccharomyces cerevisiae," Mol. and Cell Biol. 12, 1992, pp. 1357-1365.
Oren, M. et al., "Molecular Cloning of cDNA Specific for the Murine p53 Cellular
Tumor Antigen," Proc. Natl. Acad. Sci. USA, 80, 1983, pp. 56-59.
Prives, C. et al., "The p53 Tumor Suppressor Protein: Meeting Review," Genes
& Dev. 7, 1993, pp. 529-534.
Ro, Y.S. et al., "p53 Protein Expression in Benign and Malignant Skin Tumors,"
Br. J. Dermatol. 12, 1993, pp. 237-241.
Ruggeri, B. et al., "Alterations of the p53 Tumor Supressor Gene During Mouse
Skin Tumor Progression," Cancer Research 51, 1991, pp. 6615-6621.
Schneider, B.L. et al., "7,12-Dimethylbenz[∝]anthracene-Induced Mouse
Keratinocyte Transformation Without Harvey ras Protooncogene Mutations," J. Invest.
Dermatology, 101, 1993, pp. 595-599.
Seto, E. et al., "Wild-Type p53 Binds to the TATA-Binding Protein and Represses
Transcription," Proc. Natl. Acad. Sci. 89, 1992, pp. 12028-12032.
Soussi, T. et al., "Structural Aspects of the p53 Protein in Relation to Gene
Evolution," Oncogene 5, 1990, p. 945-952.
Stenger, J.E. et al., "Formation of Stable p53 Homotetramers and Multiples of
Tetramers," Mol. Carcinogen. 5, 1992, pp. 102-106.
Stephen, C.W. et al., "Mutant Conformation of p53 Precise Epitope Mapping Using
a Filamentous Phage Epitope Library," J. Mol. Biol. 225, 1992, pp. 577-583.
Sturzbecher, H.S. et al., "A C-Terminal ∝-Helix Plus Basic Region Motif
is the Major Structural Determinant of p53 Tetramerization," Oncogene 7, 1992,
pp. 1513-1523.
Vogelstein, B., "A Deadly Inheritance," Nature 348, 1990, pp. 681-682.
Vogelstein, B. et al., "p53 Function and Dysfuction," Cell 70, 1992, pp. 523-526.
Wade-Evans, A. et al., "Precise Epitope Mapping of the Murine Transformation-Associated
Protein," p53 EMBO J. 4, 1985, pp. 699-706.
Weintraub, H. et al., "The MCK Enhancer Contains a p53 Responsive Element," Proc.
Natl. Acad. Sci. 88, 1991, pp. 4570-4571.
Wolf, D. et al., "Isolation of a Full-Length Mouse cDNA Clone Coding for an Immunological
Distinct p53 Module," Mol. and Cell Biol. 51, 1985, pp. 127-132.
Wolf, D. et al., "Reconstitution of p53 Expression in a Nonproducer Ab-MuLV-Transformed
Cell Line by Transfection of a Functional p53 Gene," Cell 38, 1984, pp. 119-126.
Yewdell, J.W. et al., "Monoclonal Antibody Analysis of p53 Expression in Normal
and Transformed Cells," J. Virol. 59, 1986, pp. 444-452.
Yonish-Rouach, E. et al., "p53-Mediated Cell Death: Relationship to Cell Cycle
Control," Mol. and Cell. Biol. 13, 1993, pp. 1415-1423.
Yonish-Rouach, E. et al., "Wild-Type p53 Induces Apoptosis of Myeloid Leukaemic
Cells that is Inhibited by Interleukin-6," Nature 352, 1991, pp. 345-347.
Zambetti, G.P. et al., "Wild-Type p53 Mediates Positive Regulation of Gene Expression
Through a Specific DNA Sequence Element," Genes & Dev. 6, 1992, pp. 1143-1152.
|
Primary Examiner: Nickol; G.
Assistant Examiner: Yaen; C.
Attorney, Agent or Firm: Dunn; Michael L.
Goverment Interests
This work was supported by a grant from the National Institutes of Health (CA
31101). The United States Government may have certain rights in the invention.
Parent Case Text
This is a Divisional of application Ser. No. 08/100,496, filed on Aug. 2, 1993
now abandoned.
Claims
1. A purified peptide designated p53as peptide which peptide is present in P53
as protein of a mammal and is identical to the unique carboxyl terminal region
which distinguishes p53as protein from p53 protein.
Description
BACKGROUND OF THE INVENTION
This invention relates to p53 protein and variations thereof, and more particularly
relates to antibodies to such variations.
The p53 gene which encodes for p53 protein is defective in over half of all human
cancers. It is furthermore significant because introduction of a normal p53 gene
into a variety of cancer cells arrests their growth. Thus, defects in the p53 gene
product (that is, the p53 protein) are common in many cancers and, if corrected,
could inhibit cancer cell growth. In many human cancers, the p53 protein is inactive
because of mutation of the p53 gene. Replacement of a single amino acid can be
sufficient to change the normal folding of the p53 protein, making it inactive
as a growth control gene. In certain cells, the folding of a mutant p53 protein
can be stabilized in the normal conformation by binding to cellular factors, suggesting
that it may be possible to create peptides which bind to p53 protein and cause
it to be maintained in the normal conformation (conformations are forms of a protein
created due to folding; conformations can change without (or with) changes in amino
acid sequence). The normal conformation has the tumor suppressor effect. Cells
expressing primarily mutant p53 conformation give rise to aggressive tumors at
high frequency while cells which primarily express p53 protein in a normal conformation
give rise to slow-growing tumors at low frequency.
To date, many studies of p53 protein and its function have relied upon a specific
(PAb421) antibody thereto. Most p53 proteins studied using in vitro (cell-free)
assays of binding to DNA or modulation of transcription have used a p53 protein
purified using PAb421, and thus excluding other proteins. While p53 binding detectable
to date is sequence specific, it is low in efficiency. A model has been proposed
for activation of p53 protein for binding to DNA by modifications at the carboxyl
terminus of p53, Hupp et al. (1992) "Regulation of the specific DNA binding function
of p53",
Cell 71, 875-886, as shown in FIG.
1. Modifications include
proteolysis (loss of carboxyl terminal amino acids, phosphorylation of serine in
this region or binding of PAb421 antibody within this region.
It has been shown that p53as RNA exists in normal mouse cells and tissues and
in tumor cells (Han et al. (b) (1992), "Alternatively spliced p53 RNA in transformed
and normal cells of different tissue types",
Nucleic Acids Res., 20(8),
1979-1981; however, no protein has heretofore been found which is encoded by that RNA.
BRIEF DESCRIPTION OF THE INVENTION
In accordance with the present invention, we have discovered and purified a protein
designated herein as p53as, which protein is present in normal cells of a mammal
and is essentially identical to known normal growth controlling protein p53 of
the same mammal, at least until the final 50 amino acids of the carboxy terminal
end of the protein. "Essentially identical" means at least 80% and preferably at
least 90% sequential correspondence. It should be noted that human and mouse p53
share an 81% identity at the protein level, with a highly acidic N-terminus, basic
C-terminus and a central region containing uncharged amino acids.
The invention further includes an antibody specific for protein p53as, which
antibody is designated herein as Ab p53as. The antibody may be either a monoclonal
or polyclonal antibody and may be specific for p53as of any particular mammal such
as mice and humans.
The final 50 amino acids of p53as protein proximate the carboxy terminus of the
p53as protein, are at least partly different than the final 50 amino acids of p53
protein. The difference is at least in part due to different amino acid sequences
in the two proteins proximate the carboxy termination of the protein and may also
be partly due to a longer or shorter p53as amino acid chain when compared with
p53. It is believed that the most common and probable final few amino acids at
the carboxy termination of p53as contain the sequences SPNC and SPPC.
DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a diagram for a proposed mechanism of activation of DNA binding
by p53 protein.
FIG. 2 shows a diagram for a proposed model for p53as protein activity.
FIG. 3 is a domain map of p53 protein showing changes introduced by alternative
splicing. Mouse p53 has 390 amino acids. Domains (see Vogelstein et al., (1992),
"p53 function and dysfunction",
Cell 70, 523-526 and references therein)
are ACT: transcriptional activation domain; HSP; heat shock protein binding region
of mutant p53; HOT spots; highly conserved regions among p53 proteins in which
most transforming mutations occur; PAb240; region binding antibody conformation-specific
for certain mutants, murine amino acids 156-214; PAb246: region binding antibody
to normal wt. conformation, murine amino acids 88-109; PAb421: region binding antibody
to wt. and mutant conformation, amino acids 370-378; NUC:nuclear localization signal;
CDC2 kinase serine phosphorylation site; CK2 casein kinase serine phosphorylation
site, which is also the site of 5.8 rRNA binding; OLIGO: site of p53 self-association.
The expected changes in the C-terminal region of protein translated from alternatively
spliced wt. (Han et al., (b) (1992), supra) or mutant p53 mRNA (Arai et al., (1986)
"Immunologically distinct p53 molecules generated by alternative splicing",
Mol.
and Cell. Biol., 6, 3232-3239) are shown. The segment of intron 10 retained
in p53as mRNA is indicated as a triangle between exons. Acidic amino acids (within
a predicted alpha-helix spanning 334-356) and basic amino acids (between position
363 and 386—underlined in the C-terminal peptide sequence at bottom) are
labeled according to Sturzbecher et al. (1992), "A C-terminal a-helix plus basic
region motif is the major structural determinant of p53 tetramerization",
Oncogene
7, 1513-1523.
FIG. 4 shows a graph of reactivities with p53as peptide of anti-p53as serum
and affinity-purified antibodies detected by ELISA. New Zealand White female rabbits
were immunized with a peptide equivalent to the C-terminal 17-amino acids of p53as.
p53as peptide was synthesized at the RPCI Biopolymer facility and immunizations
were performed at RPCI Springville Laboratories. ELISA plates were coated with
2 μg peptide and reacted with pre-immune serum or day 63 immune serum at
1/500 through 1/640,000 (1/2 dilutions) and peroxidase-conjugated, affinity-isolated
goat anti-rabbit immunoglobulin. Whole immune serum (open circles) or affinity-purified
(to the peptide) anti-p53as antibodies (closed circles) were used as primary antibodies
with whole pre-immune serum (open squares) or ammonium sulfate precipitated IgG
fraction (closed squares) were used as controls.
FIG. 5 shows an anti-p53as immunoprecipitation of a 53 kd protein. Immunoprecipitation
of p53as from squamous cell carcinoma line 291.03PAT:
35S methionine-labeled
cells were lysed and 2×10
7 cpm of lysate were reacted with the
antibodies of antisera indicated: ApAs, affinity purified anti-p53as; Pre-I, pre-immune
rabbit serum; PAb421 anti-p53 antibody to an epitope absent in p53as; IgG2a, mouse
IgG idiotype control for PAb421; CM-5, rabbit polyclonal anti-p53 antibody reactive
with both p53 and p53as proteins; MW, molecular weight standards (kd). After separation
from the antibody complex by heating at 85° C. for 5 min., proteins were resolved
by electrophoresis as described in Experimental Procedures. 53 kd proteins were
detectable by PAb421 and affinity purified anti-p53as (ApAs) and rabbit polyclonal
anti-p53 serum CM5.
FIG. 6 views A through E (labeled FIGS. 6A, 6B, 6C, 6D,
6E and 6F of the drawings, respectively shows immunofluorescence
fields indicating nuclear localization of p53as antigen activity. Cells were plated
at 1.5×10
4 cells/cm
2 on glass coverslips and grown until
about 70% confluent. Nuclear reactivity was detected using affinity-purified anti-ASp53
antibody in indirect immunofluorescence assays of 100% EtOH-fixed cells (A). This
reactivity was completely blocked by competition with 1:1 ratio (by weight) of
the 17 amino acid peptide corresponding to the C-terminus of the p53as protein
(C). No competition was evident with up to a 10:1 ratio of an unrelated 16 amino
acid peptide (E). Phase contrast optics corresponding to the immunofluorescence
field are shown at right (B, D, F). Findings were similar for all epidermal cell
lines (transfectant clone 119 of 291.03RAT is shown). Fluorescence in IgG2a, IgG1
or ammonium-sulfate fractionated pre-immune serum controls were negligable (data
not shown). Bar equals 15 μm.
FIG. 7 shows comparative immunoprecipitation of p53 from proliferating (LC)
or differentiating (HC) nontransformed parental 291 cells and from 291.03RAT (03RAT)
carcinoma cells or its derivative clone 119 transfected with a mutant p53 (valine-135).
Cell lysates are incubated with 2 μg PAb421, 4 μPAb246 or 1.4μ
anti-p53as (ApAS) in NET/GEL. Immunocomplexes were incubated with 5 mg protein
A for 2 h at 4° C., centrifuged and immunoprecipitated protein was eluted
from pellets with heating at 85° C. for 15 min. After centrifugation proteins
in the supernatants were separated by electrophoresis on a 10% polyacrylamide denaturing
gel with molecular weight standards (MW, kd). Immunoprecipitable p53as protein
in clone 119 could have resulted from transfected mutant transcripts or from endogenous
wt. p53as RNA. To assist in comparisons of a particular antibody reactivity among
the cell lines, the densities of the p53 signal in each lane are provided (numbers
at bottom of each lane) relative to ApAs reactivity of 291LC as 1.
FIG. 8 shows a northern blot of p53 RNA in 291.05RAT carcinoma cells following
treatment with actinomycin D. Cells were harvested after exposure to 0.5 nM actinomycin
D or 0.2% acetone for 48 h and RNA was extracted as detailed in Experimental Procedures.
Fold-increase in signals detectable by densitometry, adjusted for loading
by comparison with 7S RNA, are indicated.
FIGS. 9A through 9F show expression of p53 (Pab421) and p53as antigen activities
in 291.05RAT carcinoma cells. Cells were treated with 0.5 nM actinomycin D for
2 days and harvested by trypsinization. Cells were permeabilized and stained in
suspension with anti-p53as and PAb421 antibodies (in the same tube) in all cases
shown except for the primary antibody control (upper left). In the 3 dot plots
at top, FIGS. 9A through 9C, the FL1 fluorescence intensity on the x-axis was FITC
(green), used to visualize Pab421 reactivity, and the FL2 fluorescence intensity
on the y-axis was phycoerythrin (red) used tovisualize anti-p53as reactivity. Prior
to incubation with cells, the anti-p53 as antibody was exposed to either p53as
peptide, which competitively removed the specific anti-p53as reactivity, or to
an unrelated peptide, which controlled for nonspecific binding to peptide, leaving
only specific reactivity to p53as protein. Events collected by flow cytometry were
single cells only as described in Experimental Procedures. Coordinates were set
on total cell data based on IgG2a and pre-immune controls to delineate four regions:
negative for both antibodies (R4) positive for anti-p53as only (R1), positive for
PAb421 and anti-p53 as (R2) and positive for PAb421 only (R3). After collecting
a file of 10,000 total events per tube (as shown in the 3 dot plots at top), additional
gates were set to exclude negative cells (R4) and to maximize the collection of
cells positive for PAb421 (histogram R3 shown), or to exclude negative cells (R4)
and cells positive only for PAb421 (R3) in order to maximize the collection of
cells positive for anti-p53as (R2). The cell cycle distribution of events from
each region (R2 through R4, FIGS. 9D through 9F) is shown in the 3 histograms at
bottom. The numbers of cells in each region expressed as a percentage of the total
cells were: unrelated peptide, R1, 0.02, R2, 1.7, R3, 17 and R4, 79 (numbers may
not add to 100 due to rounding error and to a negligible number of events outside
the windows included in the analysis); p53as peptide, R1, 0.02, R2, 0.05, R3, 19,
R4, 79. Percentages of cells in each phase of the cell cycle and total events (n)
for each region in the histograms shown were: R2, G0/G1, 19, S, 13, G2/M, 25 and
>G2/M, 43, n=2224; R3, G0/G1, 38, S, 16, G2/M, 33 and >G2/M, 12, n=6879;
R4, G0/G1, 60, S, 18, G2/M, 21 and >G2/M, 1, n=7925.
FIGS. 10A through 10F show expression of p53 (Pab421) and p53as antigen activities
in 291.05RAT carcinoma cells. Cells were cultured under low Ca
2+ conditions
(LC) which favored cell growth. Treatment and analysis was the same as for carcinoma
cells presented in FIGS. 9A through 9F. The dot plots are shown in FIGS. 10A through
10C and the histograms are shown in FIGS. 10D through 10F. The numbers of cells
in each region expressed as a percentage of the total cells were: unrelated peptide,
R1, 1.2, R1, 2, R3, 4 and R4, 92; p53as peptide, R1, 0.1, R2, 0.1, R3, 5, R4, 94.
Percentages of control cells in each phase of the cell cycle and total events (n)
for each region in the histograms shown were: R2, G0/G1, 29, S, 11, G2/M, 35 and
>G2/M, 25, n=1074; R3, G0/G1, 61, S. 15, G2/M, 22 and >G2/M, 2, n=1974;
R4, G0/G1, 78, S, 11, G2/M, 11 and >G2/M, 0.04, n=9194.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, the inventor has now discovered a novel
form of a wild type (normal) p53 protein and demonstrated that it is present in
nontransformed mouse cell strains and mouse squamous cell carcinomas. Designated
p53as, (alternatively spliced p53) it arises from a normal variation in processing
of the p53 messenger RNA (mRNA).
It has been previously demonstrated that a wild type alternatively spliced p53
(p53as) RNA exists in mouse cultured cells and normal mouse tissue at approximately
25 to 33% of the major p53 RNA form. It has been found that the alternative RNA
transcript is 96 nt longer than the major transcript due alternative slicing of
intron 10 sequences. It has now been determined that p53as protein exists in nontransformed
and malignant epidermal cells and is localized to the nucleus along with the major
p53 protein. The protein expected to be generated from the p53as transcript is
9 amino acids shorter than the major p53 protein and has 17 different amino acids
at the carboxyl terminus. In addition, p53as protein is preferentially expressed
during the G2 phase of the cell cycle and in cells with greater than G2 DNA content,
compared to the major p53 protein which is preferentially expressed in G1. The
p53as immunoreactivity is elevated and shifted to the G1 phase of the cell cycle
following actinomycin D treatment of nontransformed but not malignant cells. In
view of the dimerization and tetramerization of p53 protein which may be necessary
for its DNA binding and transcriptional activation activities, the presence of
p53as protein in cells has important implications for understanding the physiological
function(s) of the p53 gene.
It is believed that the p53as protein, similar to p53, may be used in studying
cell growth and maturation, detecting normal versus abnormal cell growth and may
be used to normalize cell growth of abnormally growing cells.
Hereafter the p53 protein recognized to date will be referred to as the
major form of p53 or simply p53; this does not rule out the existence of a cell
type in which p53as may be present in relatively higher amounts than p53. DNA is
transcribed to RNA which is then processed by removal of segments called introns
to give the nature messenger RNA which encodes protein. In alternative splicing,
a segment of an intron is retained in the coding sequence (called an alternatively
spliced messenger RNA) and makes a protein which is partly different from the major
form of the protein. The p53as sequence found in mouse normal and tumor cells has
17 different amino acids at the carboxyl terminus of the p53 protein (out of a
total of 390 amino acids in the major p53 form). This unique sequence was used
to generate antibody specific to mouse p53as. The antibody does not cross react
with the major p53 protein. It is novel, in that no other antibody reactive with
p53as has been reported or made based on available knowledge.
The p53as protein, by virtue of the replacement of 17 amino acids and loss of
9 amino acids within the carboxyl terminus, already harbors changes in this "DNA
activation" region. p53as protein in complex with itself (direr formation is possible
due to retention of acidic residues known to be important for dimerization of p53
protein) or in complex with the major p53 protein will bind to DNA and modulate
transcription of specific target genes with altered, perhaps greater, efficiency
than homodimers or homotetramers of the major p53 protein only (see FIG.
2).
Polyclonal and monoclonal antibodies to mouse p53 available prior to the
present invention do not specifically recognize p53as. These include PAb246 which
recognizes mouse p53 in its normal folding state, PAb240 which recognizes certain
mutant p53 proteins, PAb421 which recognizes the carboxyl terminal amino acids
replaced or lost in p53as. Similarly, human p53 is recognized by monoclonal and
polyclonal antibodies. No report of a human p53 generated by alternative splicing
at the carboxyl terminus has been reported and no specific antibody to human p53as
is available.
The development of antibody to p53as protein in accordance with the present invention,
permits studies of whether p53 protein and p53as protein associate in the cell,
and will permit in vitro studies of the efficiency of DNA binding and transcriptional
regulation of complexes between p53 and p53as proteins. Such antibodies may also
permit detection of cells having normal growth from cells having abnormal accelerated growth.
Mouse p53as Peptide
Alternative splicing of mouse p53 RNA results in insertion of 96 nt from
intron 10 of the p53 gene. These 96 nt encode (in frame) 17 amino acids which are
distinct from those in the major p53 RNA form, beginning at residue 365 and extending
to residue 381, followed by a stop codon which results in truncation by 9 amino
acids. This 17 amino acid peptide of alternatively spliced mouse p53, called mouse
p53as peptide is: LQPRAFQALIKEESPNC. It was produced by standard synthesis, tested
for authenticity and is stored in the laboratory. Details and procedures are as follows:
During the sequencing of p53 cDNA from the tumor and normal cells of the mouse
cloned keratinocyte model the inventor herein detected an alternatively spliced
p53 mRNA in which 96 nt of the 3′ end of intron 10 are inserted between
nt 1091 and nt 1092 of the mouse p53 gene (1 being adenine of the first ATG codon;
(Han et al. (b) (1992), supra) P53 mRNA was first cloned as a mutant p53 cDNA (M-8)
from a chemically transformed fibroblast cell line by Wolf et al., (1985) "Isolation
of a full-length mouse cDNA clone coding for an immunologically distinct p53 molecule",
Mol. and Cell. Biol. 51, 127-132; Arai et al., supra, reported the sequence
of this p53 cDNA variant, confirming its origin by alternative splicing. It appeared
to be specific to this tumor cell lineage because it was undetectable in a nontransformed
helper T-cell cDNA library. However, it has been demonstrated that wild type alternatively
spliced 53 RNA is expressed in normal cells and tissues at about 25 to 33% of the
major p53 RNA form (Han et al., (b) (1992) supra). In addition, it is present at
approximately the same ratio in the two independently-derived epidermal carcinoma
lines which overexpress p53 RNA (noted above), and thus appeared to be coordinately
elevated with the major form of p53.
The translation of alternatively spliced p53 results in the substitution of 17
amino acids and in truncation of the regularly spliced form of p53 by 9 amino acids
(FIG.
3). The protein translated from the alternatively spliced p53 RNA
lacks the serine-389 casein kinase II and RNA binding site, the epitope for PAb421
p53 antibody binding and the basic oligomerization domain, with the potential for
profound effects on p53 oligomerization, DNA binding and transcriptional activation.
In spite of the evidence for alternative mRNA species from the single p53 gene,
prior to the present invention, no wild type endogenous variants of p53 protein
have been detected. It has now been found that the alternatively spliced wt. p53
protein (designated herein as p53as) exists n normal and tumor cells of a mouse
epidermal cell transformation model and is differentially expressed during the
cell cycle relative to the major p53 form. The presence of this physiological form
of p53 protein in cells has important implications for normal p53 function and
p53 inactivation in malignancy.
In order to determine whether the p53as protein was made in cells, a polyclonal
antibody to the 17 amino acid sequence unique to the mouse p53as was generated
in rabbits. Rabbit serum collected at intervals after immunization was tested for
reactivity to p53as peptide coated on ELISA plate wells (FIG.
4). High titer
serum (shown) was affinity-purified against the 17 amino acid peptide. The reactivity
(per μg antigen) of 10 ng affinity-purified antibody was approximately equivalent
to a 1/40,000 dilution of whole anti-p53as antiserum. Anti-p53as reactivity in
the ELISA and indirect immunofluorescence assays was blocked competitively by pre-incubation
of antibody with the p53as peptide.
Immunoprecipitation
In order to determine its reactivity with cellular proteins, affinity-purified
antiserum to p53as was reacted with mouse epidermal cell lysates (FIG.
5).
A 53 kd protein was immunoprecipitated by anti-p53as. This protein migrated slightly
faster on 10% polyacrylamide gels than p53 protein immunoprecipitated by PAb421
(which binds to a carboxyl terminal epitope absent in p53as). Rabbit polyclonal
anti-p53 antibody CM5 recognized a broader band spanning the region containing
more discrete PAb421- and anti-p53as-reactive forms.
Indirect Immunofluorescence
The location and incidence of expression of p53as in cell populations grown on
coverslips was determined by indirect immunofluorescence. As shown in FIG. 6, nuclear
staining was observed with affinity-purified anti-p53as antibody. This activity
was completely blocked by competitive binding with p53as peptide (FIG.
6C).
Anti-p53as antibody reactivity in 291 nontransformed cells and carcinoma cells
was always nuclear under the conditions of these assays (data for clone 119 is
shown), and in this respect, was like PAb246 antibody reactivity which recognizes
the tumor suppressor conformation of p53. This was true even in clones of 291.03RAT
transfected with the pmMTval-135 temperature sensitive mutant of p53 in which PAB421
reactivity was cytoplasmic as well as nuclear. These results suggest that, like
the major p53 form, wt. p53as protein exerts its effects primarily in the nucleus.
p53 Expression in Nontransformed Cells and Tumor Cells
Squamous cell carcinoma 291.03RAT expresses 3-fold more p53 mRNA and up
to 10-fold less p53 protein (PAb421 and PAb 246 antibody reactivity) than the progenitor
291 cells (Han et al. (a) (1992), "Altered expression of wild-type p53 tumor suppressor
gene during murine epithelial cell transformation",
Cancer Research 52,
749-753). Comparison of the expression of p53as protein in these cell lines was
done by immunoprecipitation. As shown in FIG. 7, reactivity with anti-p53as antibody
was detected in nontransformed 291 cells and carcinoma cells. The p53as-precipitable
protein in these cell lines migrates slightly faster than the PAb421 and PAb246-precipitable
proteins, as expected from the truncation of p53as by 9 carboxy-terminus amino
acids (expected to result in an approximately 1 kd difference in molecular weight).
As expected from previous studies (Han et al. (a) supra) immunoreactivity to all
three anti-p543 antibodies was lower in 291.03RAT carcinoma cells than normal cells.
The ratio of immunoprecipitable protein in populations of proliferating cells vs.
differentiating 291 cells was higher for anti-p53as (5/1) and for PAb421 (ratio
of 2/1) than PAb246 reactivity (1/1). Elevated PAb421 reactivity in proliferating
populations also was noted by Milner (1984), "Different forms of p53 detected by
monoclonal antibodies in non-dividing and dividing lymphocytes",
Nature 20,
143-145, in studies of mouse lymphocytes. The present results suggested that p53as
protein might be differentially expressed relative to PAb421 and PAb246 protein,
dependent upon cellular proliferative or differentiative states.
Response to Actinomycin D
p53 protein has been postulated to participate in a cell cycle checkpoint regulating
entry into S phase after exposure of cells to DNA damaging agents such as actinomycin
D. Cells expressing wt. p53 (PAb421 reactivity) arrest in the G1 stage of the cell
cycle following DNA damage and p53 immunoreactivity is coordinately increased.
Prior to studies of the cell cycle distribution of p53as-positive epidermal cells,
experiments were performed to determine whether p53as protein also may respond
to DNA damage, whether it was possible thereby to maximize the percentage of p53as-positive
cells in the cell population, and to compare the response of nontransformed and
malignant epidermal cells. Moderately-differentiated squamous cell carcinoma line
291.05RAT was used for these studies because it expressed higher levels of immunoprecipitable
p53 protein than 291.03RAT, but like 291.03RAT is derived from epidermal clone
291 and has the wt. p53 gene (Han et al. (a) supra) Treatment with actinomycin
D induced p53 and p53as protein expression in two separate experiments, based on
the percentage of cells positive for reactivity with p53 antibodies by indirect
immunofluorescence (Table 1). The increase in positive cells was less for p53as
than for PAb421 and PAb246 reactivities and required a higher concentration of
actinomycin D, but this may reflect the lower abundance of p53as protein. As in
untreated 291 epidermal cells and in the 291.03RAT tumor cells expressing wt. p53,
the p53as antibody reactivity in actinomycin D-treated cells was nuclear. The p53as-positive
nuclei were also positive for PAb421 or PAb246, whereas most PAb421(+) or PAb246(+)
cells were negative for p53as antibody reactivity. The abundance of p53 RNA in
actinomycin D-treated 291.05RAT cells was increased over 3-fold according to northern
blot analysis (FIG.
8). In an independent cell preparation, reverse transcriptase-polymerase
chain reaction (RT-PCR) was performed using primers which amplify a segment from
nt 1042 to 1539 including the C-terminus coding sequences of p53 or p53as as described
previously (Han et al. (b), supra). Both p53 and p53as transcripts were increased
coordinately in samples from actinomycin-D treated cells compared to controls (data
not shown), suggesting that the response of epidermal cells to actinomycin D involve
increases in RNA abundance. The increase in abundance of p53 antibody reactivity
following actinomycin D treatment was similar to the response of ML-1 and normal
myeloid progenitor cells to γ-ray reported by Kastan et al. (1991), "Participation
of p53 protein in the cellular response to DNA damage",
Cancer Research, 51,
6304-6311. However, the abundance of p53 RNA was not increased in response to γ-ray
and the authors suggested that the observed changes in p53 immunoreactivity resulted
from a posttranscriptional mechanism. The current findings are consistent with
a functional role for p53as protein along with p53 protein in cellular response
to actinomycin D.
Flow Cytometry
The elevation of wt. p53 coordinated with G1 arrest of cells in response to various
DNA damaging agents suggested a role as a G1/S cell cycle checkpoint permitting
time for repair of DNA damage or induction of programmed cell death in severely
damaged cells (Lane, (1992), p53, "Guardian of the genome",
Nature 358,
15-16). Flow cytometry was performed in order to determine whether p53as antigen
activity was differentially expressed during the cell cycle. Cells which had been
exposed to actinomycin D or solvent were stained with antibodies to p53as and PAb421
or PAb246, taking advantage of the different species of origin of the polyclonal
and monoclonal antibodies to permit immunodetection of p53as and p53 antigens in
the same cell. Phycoerythrin (red) conjugated to anti-rabbit immunoglobulin was
used to recognize p53as and FITC (green) conjugated to anti-mouse immunoglobulin
was used to recognize PAb421 and PAb246. The specificity of anti-p53as is demonstrated
in FIG.
9. Coordinates were set based on fluorescence intensity to divide
detected events (single cells) into those positive for p53as alone (region 1, R1),
positive for p53as and PAb421 or PAb246 R2), negative for p53as and positive for
PAb421 or PAb246 (R3) and negative for both anti-p53as and PAb421 or PAb246 (R4).
The carcinoma cells were rarely positive for anti-p53as alone (FIG. 9, R1). Cells
positive for anti-p53as also were positive for PAb421 (R2, shown) or PAb246. Competition
with p53as peptide, but not an unrelated peptide, completely blocked events detectable
in the R2 region (shown for 291.05RAT in FIG.
9 and for 291 cells in FIG.
10), without reducing the percentage of R3 events, verifying the specificity
of the anti-p53as antibody. Events from each region R1 through R4 were collected
in quantity (see FIG. 9) for analysis of cell cycle distribution, represented in
the histograms (FIGS.
9 and
10). The distribution of actinomycin
D-treated 291.05RAT cells (shown) and control cells were essentially the same.
PAb421(+)/p53as(-) 291.05RAT carcinoma cells were distributed primarily in the
G0/G1 phase of the cell cycle, while p53as(+)/PAb421(+) cells were preferentially
in the G2/M phase of the cycle (FIG.
7). Particularly striking is the distribution
of p53as(+) cells in a "tail" indicating DNA content in excess of G2/M cells. Since
single cells only were collected for analysis, such cells are likely to have undergone
DNA synthesis or even mitosis, but failed to undergo cytokinesis. Inspection of
p53as(+) cells grown on coverslips revealed that most (approximately 85%) contained
two or more nuclei (data not shown), supporting the conclusion that these carcinoma
cells continued to synthesize DNA and undergo Karyokinesis (nuclear division) but
failed to undergo cell division. Nontransformed 291 cells, cultured under conditions
favoring proliferation (LC), were treated similarly for comparison with carcinoma
cells. As shown in FIG. 10, untreated cells were primarily in the G2/M stage. In
response to actinomycin D, the distribution changed in favor of G0/G1, suggesting
that both p53as protein and p53 protein reactive with PAb421 or PAb246 contribute
to G1 arrest of normal cells exposed to DNA damage. In contrast to carcinoma cells,
a population of 291 cells positive or anti-p53as reactivity alone was observed
(FIG. 10, R1). These showed a similar cell cycle distribution to cells labeled
with anti-p53as and Pab421 or Pab246. Unlike the carcinoma cells, the p53as(+)
291 cells observed on coverslips were generally mononucleated (data not shown).
The percentage distribution by cell cycle stage of nontransformed 291 and 291.05RAT
carcinoma cells treated with actinomycin D or solvent controls are presented in
Table 2. The preferential association of p53as antigen activity with G2/M and >G2/M,
the association of p53 protein (reactive PAb421 and PAb246) with G0/G1 and the
response to actinomycin D were consistent among a total of 3 independent experiments
per cell type. In nontransformed 291 cells, actinomycin D increased the percentage
of cells expressing immunodetectable p53as and p53 (PAb421 and PAb246) by approximately
4-fold and resulted in preferential accumulation of cells in the G1 phase of the
cell cycle compared to solvent controls. In contrast, the 291.05RAT tumor cells
showed little difference in the percentage of cells in G1 in response to actinomycin
D treatment, suggesting that the p53 protein in these cells was less capable of
causing G1 arrest, even though the percentages of cells positive for PAb421 and
PAb246 were elevated.
Human p53as Peptide
Human p53as protein is defined herein as the human p53 protein 1) which is
generated from a p53 transcript detectable in human cells by reverse transcriptase
(RT)/polymerase chain reaction (PCR) (as described below) which is itself generated
by alternative splicing of a region of intron 10 of the human p53 gene, and 2)
which contains carboxyl terminal amino acids distinct from those of the major human
p53 protein. (Singular is used but is not meant to rule out the possibility that
more than one p53as protein is made in human cells). Antibodies to human p53as
peptide permit verification of the presence of p53as in human cells.
Prior to the present invention, no human p53as protein in normal cells (alternatively
spliced at the carboxyl terminus, analogous to mouse p53as) has been reported or
suggested. The mouse and human p53 cDNA sequences are 81% identical and have functional
domains in common. There are three lines of evidence pointing to the existence
of human p53as. First, two PCR products have been amplified by RT/PCR from human
cDNA using primers which span intron 10 created from mouse exon 10 and exon 11
sequences. Second, two p53 proteins are detectable by molecular weight differences
in western immunoblots or immunoprecipitations using polyclonal antibodies to human
p53, for example, by Gupta et al. (Proc. Natl. Acad. Sci. 90: 2817-2921, 1993)
who used antibody CM-1 and protein from Hodgkins disease tumor cells. This has
been attributed to either distinct phosphorylation states or a polymorphism at
amino acid 72. CM-1 is expected to react with multiple regions on the p53 gene
and thus would be expected to react with both human p53 and p53as proteins. Thus
the presence of human p53as could account for the data in the literature demonstrating
two p53 proteins distinguishable by molecular weight. Third, human intron 10 encodes
a peptide which has a motif (SPPC) similar to the last 4 amino acids of the mouse
p53as (SPNC).
The peptide unique to human p53as is identified as follows:
Primers are constructed which are used to amplify by polymerase chain reaction
(PCR) a region of the human p53 cDNA including part of exon 10, all of intron 10
sequences retained in the alternatively spliced p53 mRNA and part of exon 11. Human
cDNA is generated from cellular RNA (isolated by guanidinium/cesium chloride extraction)
by RT/PCR. RT/PCR is carried out as follows: 5 μg of human cell total RNA
is combined with 1 mM each of 4 deoxynucleotidetriphosphates, 5 μg random
hexamer primer (to make cDNA to all available mRNA), 5 μl AMV reverse transcriptase
(RT, 5 to 10 units per al), 3.5 mM MgCl
2 (or as optimized), 2.5 μl
RNasin 5 μl PCR buffer (Perkin Elmer; without Mg
2+) and depc-treated
water to adjust the volume to 50 μl. Reaction is allowed to proceed at 23°
C. for 10 minutes, 42° C. for 1 h and 95° C. for 10 minutes then transferred
to ice. An additional 0.2 μl of RT is added and the reaction is repeated
1X. 1 μl of the RT reaction product mix is used to provide the cDNA templates
for human p53 and p53as C-terminal regions for amplification by PCR. PCR is optimized
to obtain efficient production of the specific product and minimize background.
PCR is performed for 35 cycles of denaturation (95° C., 30 sec), annealing
(60° C., 1 min) and extension (72° C., 3 min) in a DNA thermal cycler.
Amplified fragments of human p53 and p53as C-terminal coding regions are desalted
by centricon ultrafiltration, digested with the restriction enzymes appropriate
to the synthetic primers (see example below) and isolated from low melting temperature
agarose for cloning into pGEM3zf(+) (Promega) for the sense strand or pBluescript
KS(+) (Stratagene) for the antisense strand and transfected into
E. coli for
production and sequencing as we have described (Han et al. supra). Human cells
as the source of RNA include (but are not limited to) normal human epidermal keratinocytes
and two clones (B and F2A) of squamous cell carcinoma line SCC-12. The PCR amplification
product generated using the primers which span intron 10 include the major p53
transcript and p53as transcript(s). These are distinguished by differences in molecular
weight and/or by sequencing of the amplified PCR products as has been demonstrated
previously for mouse p53as transcripts (Han et al. (b) supra). Sequencing of the
PCR products permits determination of the sequence of the protein encoded by human
p53as RNA. The amino acid sequence of the human p53as protein is compared to that
of the major human p53 protein to determine the unique sequence at the carboxyl
terminal region of human p53as protein.
An example of a primer set which spans intron 10 of the human p53 gene is: 5′
primer/sense strand ATCGAAGCTTGAGATGTTCCGAGAGAGCTGAAT (within exon 10 beginning
at nucleotide 17,593 of the genomic p53 sequence Genbank accession No. X54156,
with additional nucleotides added to the 5′ end, ATCG and restriction endonuclease
site HindIII to facilitate cloning and sequencing—underlined) and 3′
primer antisense strand ATCGTCTAGAGCTTCTGACGCACACCTATTG (within exon 11 beginning
at nucleotide 18794 in the 5′ to 3′ direction to nucleotide 18774,
with ATCG and XbaI restriction endonuclease site added—underlined).
Polyclonal Antibody Specific for Mouse p53as Protein
Polyclonal antibody to mouse p53as unique peptide noted above has been
raised in rabbits, its high titer has been determined by enzyme linked immunosorbent
assay (ELISA), its specificity for p53 protein has been determined by immunoprecipitation
from rouse cells, western immunoblotting of anti-p53 precipitable protein to a
polyclonal antibody to p53 (CM5, reactive with epitopes shared by p53 and p53as
proteins), ability of the peptide to competitively block reactivity in cells and
in western immunoblots, and the ability of the p53as peptide to block binding of
p53as antibody but not block the binding other p53 antibodies (PAb421 and pAb246)
which bind to epitopes distinct from the unique region of p53as.
The polyclonal anti-peptide antibody is produced in rabbits as described in General
Procedures below.
Monoclonal Antibody Specific for Mouse p53as Protein
Hybridoma cell lines have been produced by fusion of spleen cells from
BALBc mice immunized with mouse p53as peptide. The procedure is found in General
Procedures below.
The monoclonal antibodies from each hybridoma cell line producing specific antibody
as determined by ELISA is to be tested for reactivity with mouse cellular p53as
by immunoprecipitation, western immunoblotting and immunofluorescence as described
for polyclonal antibody to mouse p53as above. Specificity is determined by competition
with mouse p53as peptide. Such a hybridoma cell line has been deposited with American
Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 on Jul.
14, 1994, as ATCC Designation HB 11685.
Polyclonal Antibody Specific for Human p53as Protein
The peptide unique to human p53as, determined as described above, will be synthesized
and used to immunize rabbits following the procedures used to generate polyclonal
antibody to mouse p53as, described in the manuscript provided and in General Procedures.
An example of such a peptide selected based upon similarities with mouse p53as
unique peptide is the following 20 amino acid peptide encoded by human intron 10
sequences: REKGHRPSHSCDVISPPCFC.
Monoclonal Antibody Specific for Human p53as Protein
The peptide unique to human p53as, determined as described above, will be synthesized
and used to immunize mice following the procedures used for polyclonal antibody
to mouse p53as described above and in General Procedures below.
Note that the species specificity of each antibody will be determined; that
is, for example, testing of whether an antibody generated to mouse p53as peptide
also binds human p53as and whether antibody to human p53as binds mouse p53as protein
will be performed.
General Procedures for Immunizing Mice with Synthetic p53as Peptides (Mouse
or Human)—Monoclonal Antibody Production
The procedures to be used are based on standard procedures for generating monoclonal antibodies.
The p53as peptide of mouse or human origin is stored protected from light and
oxygen until use. It is reconstituted just prior to injection. Unmodified peptide
is used as immunogen initially because this was successful in the generation of
polyclonal antibodies to mouse p53as protein. Alternatives which will be used if
necessary to improve immunization include conjugation to another protein (for example,
ovalbumin)), or use of full length p53as protein generated in insect cells using
a baculovirus vector system. Such vectors containing p53as cDNA have already been
made in this laboratory for production of mouse p53as protein.
For each mouse, 250 μl (30 to 50 μg of peptide) is emulsified with
an equal volume of Freund's complete adjuvant.
The emulsion is injected into BALB/c female mice (weighing approximately 20 g
each) intradermally at multiple sites along the dorsum and intraperitoneally. (If
necessary to improve the immunization response, an alternative mouse strain will
be used.)
Four weeks later, boosting of the mice with an intraperitoneal injection of
100 μl (20 μg peptide) mixed with Freund's incomplete adjuvant is performed.
Two weeks later, serum is tested for antibody titer by ELISA as per manuscript provided.
Three days before the fusion, the best responder is reboosted with an intravenous
injection of 100 μl (20 μg peptide) without adjuvant.
Cell Fusion
Preparing Myeloma Cells for Fusions
Myeloma cells are thawed from liquid nitrogen and placed in culture one week
prior to the fusion. The cells are grown in order to reach a cell density of 5×10
5
cells/ml one day before the fusion. On the morning of the fusion, 10 ml of
cultured cells are diluted with an equal volume of CMEM.
| |
| Complete Media Preparation (CMEM): |
| |
| |
| 0.5 ml |
gentamicin sulfate |
| 5.0 ml |
Pyruvic acid stock solution |
| 5.0 ml |
Hypoxanthine stock solution |
| 5.0 ml |
Thymidine stock solution |
| 5.0 ml |
Oxaloacetate stock solution |
| 5.0 ml |
Penicillin G stock solution |
| 5.0 ml |
Bovine insulin stock solution |
| 50 ml |
NCTC 109 (MA Bioproducts) |
| 100 ml |
Fetal Bovine Serum (heat inactivated) |
| |
The above solutions are added to a sterile 500 ml bottle and volume is adjusted
to 500 ml with Dulbecco's MEM (with L-glutamine, with D-Glucose at 4500 mg/L, without
Sodium Pyruvate, Gibco). The medium is sterilized by 0.2 micron filtration and
tested for contamination by incubate overnight at 37° C. CMEM is stored at
4° C. and used within 2 weeks.
Preparing Splenocytes for Fusions
The mouse is sacrificed and the spleen is aseptically removed. Contaminating
tissues are dissected and discarded.
The spleen is ground on a stainless steel mesh to release the cells.
The splenocytes are washed twice with 10 ml of medium without serum and the cells counted.
Cell Fusion
Myeloma cells are washed once and resuspended in medium without serum.
The myeloma cells and splenocytes (1:10) are combined in medium without serum.
These cells are centrifuged together at 800 g for 5 min.
The supernatant is removed. 50% PEG 1500 is added to the cell pellet slowly over
1 min while resuspending the cells by stirring with the end of the pipet. Stirring
is continued for an additional minute. Then 1 ml medium without serum is added
to the cell suspension over the next minute. Finally, 9 ml medium is added over
2 min with stirring. The cells are centrifuged at 400 g for 5 min.
The supernatant is removed and the cells resuspended in 30 ml HAT media.
HAT Media Preparation:
HAT medium is prepared the same as CMEM but 1.0 ml aminopterin stock solution
and 1.0 ml glycine stock solution are added before bringing media to a total volume
of 100 ml.
100 ml of cells are dispensed into the wells of 96-well plates. The plates are
incubated in a 5% CO
2 atmosphere.
Single-Cell Cloning
Screening positive clones by ELISA.
About 50 μl of culture supernatant are placed in the wells of another
96-well microtiter plate that has been coated with p53as synthetic peptide appropriate
to the antibody (mouse or human p53as peptide). Positive clones are detected by
ELISA as presented in the manuscript attached.
Preserving positive clones.
After a positive well has been identified, the cells are transferred from the
96-well plate to the well of 24-well plate containing the same medium. After the
24-well plate culture becomes dense, it is transferred to 100-mm dish. Freeze the
cells at the 100-mm dish stage.
Limiting Dilution
On the day before cloning, a spleen cell suspension is prepared according to
the
procedure described in the fusion technique above. 10
3 spleen cells
per well are plated into a 96-well plate (using one drop per well) A minimum of
105 proliferative hybridoma cells from a 25 cm
2 flask
are used for cloning.
The hybridoma cells are subcultured 24-48 hours before cloning by diluting an
actively growing culture 1:1 with fresh media. Cells in mid-log phase are used
for the limiting dilution.
Cell number is adjusted to 10
5 viable cells per ml (cell viability
of >70%).
Serial 10-fold dilutions are made (e.g. 10
4, 10
3 per ml.)
In a 50 ml tube, 0.30 ml of the 10
3 hybridoma cells is added per ml
and 29.7 ml of CMEM.
One drop from a 2.0 ml (50 μl) pipette of the cell suspension is added
to each well of the 96 well plates with the spleen cells prepared the day before cloning.
Cultures are observed every 2 to 3 days and wells with a single cell clone
are marked.
Clones are assayed for anti-p53as activity by ELISA when they cover 25% of
the well. Positive clones are transferred to 24 well plates, to 100-mm dishes,
then hybridoma cells are cryopreserved in Nunc cryotubes.
Ascites Production
8 week old BALB/c mice are injected with 0.4 ml of pristane intraperitoneally.
After two weeks, 0.5 ml cells (10
5 cells) in mid-log phase are injected
into each pristane-treated mouse.
After 2-3 weeks, the mice are sacrificed and the ascitic fluid harvested.
Ascites is centrifuged at 1000 g for 10 min, the middle layer is collected
and kept at -20° C.
Monoclonal antibodies are tested by ELISA, indirect immunofluorescence,
immunoprecipitation and western immunoblotting for specificity to p53as in appropriate
cells (mouse or human). Ability of the antibody reactivity to be competitively
blocked by the peptide used to generate it is tested.
General Procedures for Immunizing Rabbit
